ABSTRACT Malaria in the south-west Pacific is transmitted by members of the _Anopheles punctulatus_ group which comprises 12 cryptic species with overlapping morphology. The most widely

distributed species of the group is _Anopheles farauti s.s._ (_An. farauti_ 1) found throughout northern Australia, Papua New Guinea, eastern Indonesia, the Solomon Islands and Vanuatu. A

study of the population structure of this species using PCR-RFLP analysis on the ribosomal DNA internal transcribed spacer 1 reveals five genotypes which had distinct geographical

distributions. Where these distributions overlap, genotype hybrids can be identified. Heteroduplex analysis of the ITS2 region reveals combinations of nonhomogenized ITS2 sequences and

s.s_. may contain multiple loci for the rDNA gene family or that the homogenization of these regions is relatively slow and can be used in genetic studies of population distribution and

structure. SIMILAR CONTENT BEING VIEWED BY OTHERS INTEGRATED TAXONOMY TO ADVANCE SPECIES DELIMITATION OF THE _ANOPHELES MACULIPENNIS_ COMPLEX Article Open access 28 December 2024 THE ORIGIN

OF ISLAND POPULATIONS OF THE AFRICAN MALARIA MOSQUITO, _ANOPHELES COLUZZII_ Article Open access 26 May 2021 POPULATION GENOMIC EVIDENCE OF A PUTATIVE ‘FAR-WEST’ AFRICAN CRYPTIC TAXON IN THE

_ANOPHELES GAMBIAE_ COMPLEX Article Open access 10 September 2024 INTRODUCTION There is a growing body of evidence to suggest that within anopheline taxa genetic variation can be related to

the adaptation of mosquito populations to their environment (Coluzzi et al., 1979). These genotypes have been associated with different ecotypes and geographical distribution, providing

evidence of barriers to gene flow between genotypes (Appawu et al., 1994; Favia et al., 1997). Genotypes appear to relate to behavioural characteristics which have important implications in

malaria transmission (Coluzzi et al., 1979; Petrarca & Beier, 1992; Mnzava et al., 1994). Much of this work has been based on studies of the _An. gambiae_ complex in Africa using

polymorphic chromosomal inversions. Recently, DNA based techniques have been applied to these studies and there appears to be good agreement, between the chromosomal- and DNA-based genotypes

(Favia et al., 1997). In the south-west Pacific, New Guinea, the Solomon Islands and Vanuatu are highly malarious. The major vectors belong to the _Anopheles punctulatus_ group which

includes 12 species. Some members of this group cannot be reliably identified by morphological markers, making field studies on their biology and behaviour difficult; only recently has work

on their distribution been initiated (Foley et al., 1994; Cooper et al., 1995, 1996, 1997). This work has been facilitated by the development of a PCR-RFLP technique utilizing sequence

variation in the ribosomal DNA (rDNA) internal transcribed spacer 2 (ITS2) region, permitting accurate identification (Beebe & Saul, 1995). The rDNA transcriptional unit is tandemly

repeated (>100 copies per genome) and separated by a nontranscribed intergenic spacer (IGS). Each transcribed unit has two internally transcribed spacers; ITS1, which separates the 18S

and the 5.8S rDNA subunits and ITS2, which separates the 5.8S and 28S rDNA subunits. A process termed concerted evolution is thought to maintain sequence integrity between the rDNA repeat

units through sequence homogenizing mechanisms such as gene conversion and unequal crossover, where recom- bination occurs between the rDNA repeat units within or between chromosomes (Dover,

1982; Schlotterer & Tautz, 1994). Some organisms display little intraspecific ITS sequence and length variation (e.g. Fenton et al., 1997) but others show high levels of variation (e.g.

Wesson et al., 1992). The ITS1 is closely linked to the ITS2 but displays higher levels of sequence variation (Miller et al., 1996; Tang et al., 1996). Polymorphic variants amplified by PCR

can be studied by heteroduplex analysis (e.g. Tang & Unnasch, 1997) which is sensitive to DNA secondary structure, i.e. when two or more variant ITS2 populations are amplified, the

double-stranded products will contain both homoduplexes (ITS2 double-stranded duplexes of 100% homology) and heteroduplexes (duplex homology of variants sequences is <100%) which can be

resolved on an acrylamide gel. In this paper, we report on the development of ITS-based techniques for identifying genotypes of _An. farauti_ (_sensu stricto_, previously _An. farauti_ 1) to

investigate their distribution and gene flow between geographical populations. MATERIALS AND METHODS MOSQUITO MATERIAL Mosquitoes (_An. farauti s.s._) were collected from areas in northern

Australia, Torres Strait, Papua New Guinea (PNG), the Solomon Islands and Vanuatu during the period 1989–97, with the exception of the Rabaul material (site 28), which was collected in 1968

and has been maintained in colony. Collection sites are indicated in Fig. 1. Specimens were collected as larvae or as adults using CO2-baited light traps or human biting catches. Larval

material, in most cases, was reared to adults. Where this was not possible, specimens were preserved in 100% ethanol. Adults were preserved at −70°C, in alcohol or dried on silica gel.

Specimens were identified using the PCR-RFLP procedure of Beebe & Saul (1995). DNA EXTRACTION Single mosquitoes (adults or larvae) were ground in a 1.5 mL centrifuge tube containing 50

μL of lysis buffer (1.0 M NaCl, 0.2 M sucrose, 0.1 M Tris-HCl (pH 9.0), 0.5 M EDTA and 0.5% SDS). Tubes were pulse centrifuged to concentrate the homogenate in the bottom of the tube prior

to incubation at 65°C for 30 min. Seven μL of 8.0 M potassium acetate was added to each tube, mixed, placed on ice for 15–30 min and centrifuged for 15 min at 20 000 _G_. Supernatants were

placed in a new tube, to which 100 μL of 100% ethanol was added, then incubated for 5 min at room temperature and centrifuged at 20 000 ;_G_ for 15 min. Supernatants were removed, 100 μL of

70% EtOH was added and tubes were centrifuged again at 20 000 ;_G_ for 5 min. Supernatants were removed, then tubes were air-dried and pellets resuspended in 50 μL TE containing RNase (5

μg/mL). PRIMER SELECTION AND DESIGN The ITS2 primers ITS2A (5′-TGTGAACTGCAGGACACAT) and ITS2B (5′ TATGCTTAAATTCAGGGGGT) were from Beebe & Saul (1995). The ITS1A forward primer was

designed from the 18S gene (5′-CCTTTGTACACACCGCCCGTCG). The ITS1B primers were designed from the reverse complement of the ITS2A primer on the 5.8S gene (5′-ATGTGTCCTGCAGTTCACA). ITS

AMPLIFICATION The PCR was carried out in 0.5 mL centrifuge tubes in a 25-μL volume using a Thermal cycler (Hybaid Omnigene). The final PCR mixture contained 50 mM KCl, 10 mM Tris-HCl pH 9.0,

1 mM MgCl, 0.125 mM of each dNTP, 60 ng of each primer, 5% DMSO, 1.0 unit of Taq polymerase and 2–50 ng of purified genomic DNA. Cycling involved an initial denaturation at 94°C for 4 min

then 35 cycles of 94°C for 1 min, 51°C for 1 min, 72°C for 1 min (2 min for ITS1) using minimum transition times. PRODUCT DIGESTION AND VISUALIZATION ITS1 PCR products were run on a 1.0%

agarose gel containing 0.5 μg/mL ethidium bromide and visualized at 312 nm. PCR product was digested by adding 5 μL of PCR reaction (ITS1 or ITS2) to 5 μL of 2× _Msp_I buffer containing 2

units of _Msp_I per reaction. Reactions were incubated at 37°C for 60 min and digested PCR products were run on a 3% agarose gel containing 0.5 μg/mL ethidium bromide and visualized at 312

nm. ITS2 POLYMORPHISM IDENTIFICATION USING HETERODUPLEX ANALYSIS (HDA) To identify ITS2 variants present in the rDNA array, 5 μL of the ITS2 PCR reaction from each mosquito was run on a 7.0%

nondenaturing PAGE gel (NOVEX) containing 5.0% glycerol for 2.5 h at 200 V. The NOVEX gel system was partially immersed in an ice/water mixture to prevent heating of the gel and subsequent

denaturing of the DNA duplex. The gel was stained with ethidium bromide (0.5 μgmL) for 3 min, then visualized at 312 nm. ITS2 CLONING AND SEQUENCING ITS2 PCR products from mosquitoes

representing each of the genotypes were ligated into the vector pGEM-T according to manufactures recommendations (Promega). Ligation products were transformed into _Escherichia coli_ (DH5α)

according to the manufacturer’s recommendations. Positive colonies (white/pale blue) were stabbed with a sterile pipette tip and immersed briefly into a 0.5-mL PCR tube containing a 25 μL

PCR reaction using the ITS2A and ITS2B primers. The reaction was cycled for 25 cycles at 94°C–1 min, 50°C–1 min, 72°C–1 min using minimal transition times. ITS2 products were identified via

a 1.0% agarose gel and positive clones were mixed together in sets of two for heteroduplex analysis to identify the polymorphic sequences, i.e. 5 μL of two amplified clones were added to one

tube and denatured at 95°C for 5 min and allowed to return to room temperature. ITS2 mixtures were then run in a 7.0% PAGE gel as above. Clones displaying appropriate duplex banding

patterns were purified using BRESA-CLEAN glassmilk chromatography and sequenced in both directions on an ABI 377 automated sequencer using ITS2A and ITS2B primers. RESULTS ITS1 PRODUCT SIZE

DNA from individual mosquitoes was used as a template for PCR amplification of the ITS1 and delivered products of approximately 1200 bp and 1400 bp (Fig. 2). The 1400-bp product was

generated from mosquitoes from northern Australia and Western Province of PNG sites (1–13). A 1400-bp product was also identified from Guadalcanal (site 29) in the Solomon Islands and

Vanuatu (site 30). The mosquitoes collected east of the Fly River delta in the Western Province of PNG (sites 15–19) and Rabaul (site 28) displayed a 1200-bp product. The 1200-bp and 1400-bp

populations overlapped at site 14 in the Western Province. This site consisted of two collection locations 20 km apart (shown as one site on the map). The specimens examined from these two

locations displayed bands at both 1200 bp and 1400 bp and were regarded as nonhomogenized ITS1 sequences and genetic hybrids. A third band at 1300 bp was occasionally produced from these

specimens and was identified as a heteroduplex formed between the 1200-bp and 1400-bp products. This 1300 bp band could be replicated by mixing and denaturing both the 1200-bp and 1400-bp

amplification products into a single tube and electrophoresing on a 1.0% agarose gel (data not shown). All three products (1200 bp, 1300 bp and 1400 bp) were observed in most of the _An.

farauti_ material examined from the northern coast of PNG (sites 20–27). The ITS1 PCR products from this area displayed a high degree of heterogeneity within copies of the ITS1. Results of

the ITS1 amplification are summarized in Table 1. Product sizes are displayed in Fig. 2. ITS1 PCR-RFLP ANALYSIS Following a _Msp_I restriction digest of the ITS1 PCR product, sequence

polymorphisms were more visible between geographical populations and could be further separated into genotypes based on distribution (Fig. 3). A pattern of 450, 280, 180 and 150-bp bands

from Northern Territory material appeared homogeneous with no evidence of intraindividual polymorphism and was designated ITS1-NT (sites 1–5). This genotype was also identified from Vanuatu

mosquitoes (site 30). A pattern of 480, 380, 180 and 150-bp bands designated ITS1-QLD/WP, was identified from Queensland, Torres Strait, Western Province (sites 6–13) and Guadalcanal (site

29). However, populations of mosquitoes from Queensland, Torres Strait and Western Province appeared to display evidence of past gene flow from the ITS1-NT population, because of the

presence of a low-intensity 280 bp band. Mosquitoes from the Torres Strait and Western Province revealed a stronger 280-bp band, indicating a higher ITS2-NT sequence copy number in the rDNA

array than found in the more southern Queensland populations. This band was not present in material from Guadalcanal in the Solomon Islands. A digest of the 1200-bp ITS1 product from the

southern coast of PNG (sites 15–19) and Rabaul (site 28) gave major bands at 550, 350, 150 and 100 bp and was designated as ITS1-sPNG. Where ITS1-QLD/WP and ITS1-sPNG overlapped (site 14),

bands from both genotypes were visible (Fig. 3). A similar banding pattern was produced from sites on the north coast of PNG, where 550, 480, 380 and 350-bp bands of varying intensity again

suggested the presence of both ITS1-sPNG and ITS1-QLD/WP sequences. These complex and variable hybrid genotypes were designated ITS1-nPNG and regarded as separate from the RFLP profile of

site 14. However, two mosquitoes from site 25 displayed a single band at 1200 bp that generated the ITS1-sPNG pattern. ITS2 DUPLEX ANALYSIS AND SEQUENCING Seven distinct duplex banding

patterns were identified from _An. farauti s.s._ mosquitoes and are displayed in Fig. 4; NT, QLD/WP, sPNG, nPNG, RA, GU and VA (Table 1). Sequencing of the duplex bands identified 13

sequence types (GenBank AF104314, AF104315–AF104326) and these are summarized in Table 2. The ITS2 duplex patterns corresponded to the same geographical locations identified by the ITS1

genotypes with the addition of the Rabaul (RA), Guadalcanal (GU) and Vanuatu (VA) genotypes. Most Northern Territory specimens (sites 1–5) showed two ITS2 sequence types (Fig. 4, sequences 1

and 3). Only one mosquito from site 1 and one from site 3 (Northern Territory) had a single homogenized band. Mosquitoes from Queensland, Torres Strait and Western Province (QLD/WP

genotype, sites 6–13) also showed the presence of two duplex bands which when sequenced were of types 1 and 5. Mosquitoes from site 14, however, displayed several ITS2 duplex bands; two of

the stronger bands were types 1 and 5. The material from sites 15–18 (sPNG) gave a single homogenized ITS2 band of type 8. Site 19 revealed at least two ITS2 sequences, i.e. more than one

band. Most mosquitoes from sites along the northern coast of PNG (sites 20–27) displayed a highly polymorphic ITS2 genotype of at least four bands in most cases. Material from these sites

were of types 6, 8, 9, 10, 11, 12 and 13. Specimens from northern PNG had variable band intensities between sites but were consistent within sites. Moreover, at site 25, two mosquitoes which

had a 1200-bp ITS1 band, had a two-band heteroduplex indicating that only two sequence types (9 and 10) were present in these individuals (data not shown). Specimens from Rabaul (RA) shared

sequence type 13 with nPNG but also displayed the type 7 sequence. The heteroduplex from the GU genotype (site 29) on Guadalcanal gave sequence types 2 and 4. Specimens from Vanuatu (site

30, VA genotype) gave only a single homoduplex of sequence type 2. Alignment of sequences indicated, as with the ITS1-RFLP analysis, that the Guadalcanal and Vanuatu populations have close

affinities with the NT and QLD/WP genotypes. All four genotypes were represented by sequence types 1, 2, 3, 4, and 5 (Table 2). The PNG genotypes, sPNG, nPNG and RA, also grouped together

and contained sequence types 6, 7, 8, 9, 10, 11, 12, and 13. DISCUSSION Analysis of the ITS1 region of _An. farauti s.s._ produced RFLP profiles that identified five distinct genotypes in

this species and showed evidence of integration between populations. Analysis of the ITS2 region, using both heteroduplex analysis and DNA sequencing, identified seven genotypes that

followed closely those identified using the ITS1. Relationships between genotypes were also seen in the ITS2 analysis though, unlike in the ITS1 analysis, the direction of gene flow could

not be determined. DISTRIBUTION _Anopheles farauti s.s._ is a coastal species and the larvae are tolerant of saline conditions (Sweeney, 1987) though they will also breed in fresh water. The

distribution of this species is continuous from northern Australia east to the islands of Vanuatu (Foley et al., 1994; Cooper et al., 1996, 1997). The topography of the coastline throughout

this region is fairly uniform. Breeding sites frequented by this species are the margins of creeks and rivers entering the sea, and pools and swamps formed behind beaches and coastal sand

dunes. These types of sites are common throughout the entire range of this species. _Anopheles farauti s.s_. is capable of crossing large expanses of water as shown by its presence in the

Solomon and Vanuatu islands. Oceans present clear mating barriers between populations permitting independent evolution of populations into detectable genotypes such as in Guadalcanal and

Vanuatu. However, genetically isolated populations and gene flow barriers were also identified within land masses such as Australia and PNG. Within Australia, two genotypes were identified;

the Northern Territory (NT) genotype and the QLD/WP genotype found in Queensland and the Western Province of PNG. Australia represents the southern limit of _An. farauti s.s._ where it is

rarely found below the 1200 mm isohyet level, implying that it is intolerant of drier, arid conditions (Roberts, 1948; Cooper et al., 1996). The southern coastline of the Gulf of Carpentaria

is below the 1200 mm isohyet level under normal rainfall conditions, and would act as a barrier to gene flow between Northern Territory and Queensland populations. However, the ITS1

PCR-RFLP analysis suggests directional gene flow from the NT to the QLD/WP genotype. Northern Australia experiences distinct wet and dry seasons which affect the distribution of _An.

farauti_ _s.s._ in northern Australia (Russell & Whelan, 1986). Successive years of protracted wet seasons may enable populations from Northern Territory and Queensland to expand briefly

into this southern Gulf region and hybridize. Drying to the west of this hybrid zone may account for the apparent easterly movement of the NT genotype. The results obtained using the ITS2

complement those using ITS1, as the ITS2 sequence type 1 is present in both the NT and QLD/WP genotypes. Moreover, mosquitoes from the Western Province and Torres Strait appeared to contain

more copies of the NT genotype ITS1 sequence (observed as a more intense 280-bp band) than mosquitoes from the lower latitudes of Queensland (sites 6 and 7). This phenomenon suggests

limitations to genetic movements south along the Queensland east coast. The QLD/WP genotype was found in north Queensland, the Torres Strait Islands and the Fly River delta region of PNG.

The climate to the north of the Fly River changes from a wet/dry monsoon climate to continuous wet conditions with rainfall above 2500 mm and high humidity (McAlpine et al., 1983). The ITS1

analysis demonstrated hybrid QLD/WP and sPNG genotypes suggesting this region may be a hybrid zone. However, the failure to detect the sPNG genotype south of this area implies a barrier to

gene flow such as the more arid, drier conditions found there. The sPNG genotype extended east along the southern coast of PNG into Milne Bay at site 19, a region that separates the sPNG

genotype from the highly polymorphic nPNG genotype. The Milne Bay region may act as a bottleneck to the movement of _An. farauti s.s_., as throughout this area the foothills of the main

mountain range of New Guinea form much of the coastline, affording fewer breeding sites. It appeared from the ITS2 heteroduplex analysis that material from site 19 displayed ITS2 sequence

complexity unlike the nPNG or the sPNG genotype sites, even though the ITS1 showed the same material to be of the sPNG genotype. The highly polymorphic nPNG genotype extended along the

northern PNG coastline as far as site 27 near the Irian Jaya border, which was the limit of collections. These complex nonhomogenized ITS1 hybrid genotypes appeared to be mixtures of the

sPNG and QLD/WP genotypes, e.g. sites 20–26 showed bands of variable intensity at 550 (sPNG specific), 480 and 180 bp (QLD/WP, NT specific). Nevertheless, it is important to note that

PCR-RFLP results should be perceived as only an indication of sequence similarity, as there is the possibility that different ITS1 sequences may generate the same RFLP pattern. The ITS2 data

supported the observation of combinations of spacer sequences occurring at variable copy numbers by generating duplex banding patterns that also varied in band intensity (Fig. 4). Within

the nPNG genotype, similar band intensities were observed within sites, but variation between sites suggests the presence of independent population dynamics within and between collection

sites along the northern PNG coastline as mosquito populations are homogenizing the rDNA arrays at different rates. For example, two _An. farauti s.s._ mosquitoes collected from site 24

contained only two ITS2 sequence types and a single ITS1 band at 1200 bp which delivered an RFLP of the sPNG genotype. These mosquitoes appear isolated as a sexually mating population,

displaying none of the ITS heterogeneity identified in other proximal populations. These mosquitoes were taken from the same CO2 bait trap collection and suggest the presence of independent

sympatric population dynamics. Within Africa, chromosomal polymorphism within _An. gambiae_ and _An. arabiensis_ has been associated with mosquito behaviour and human presence (Coluzzi et

al., 1979; Petrarca & Beier, 1992; Mnzava et al., 1994). Tang et al. (1996), working on blackflies, reported that control efforts directed against savanna-dwelling species of the

_Simulium damnosum_ complex in west Africa, resulted in a higher degree of rDNA ITS1 intraspecific heterogeneity compared to the uncontrolled forest-dwelling species _S. damnosum_ _s.s._ In

PNG it would be difficult to implicate these factors as the reasons for the degree of elevated polymorphism in the nPNG populations. _Anopheles farauti s.s_. does not necessarily have a

close association with man (Cooper et al., 1995), nor is it highly anthropophilic (Charlwood et al., 1985). Coastal human populations are similar in density along the southern and northern

coastlines of PNG and similar control efforts using DDT indoor spraying have been carried out in both areas over the past 20 years, yet far less polymorphism was observed in the sPNG

populations. Similar DDT spray programmes were also carried out in the Solomon Islands and Vanuatu without apparent increases in genetic complexity within their _An. farauti s.s._

populations. If the range of _An. farauti s.s_. is the result of dispersal, then the centre of origin of this species is likely to be the region where the greatest genetic complexity or

polymorphism occurs (Cranston & Naumann, 1991). This would suggest that _An. farauti s.s_. originated in northern PNG and has radiated outwards along the coastlines and islands of the

south-west Pacific. Dispersal of this species would not be difficult given that the climate is fairly uniform and breeding sites are plentiful. Larvae tolerate saline conditions and have

been found breeding in canoes and boats, possibly facilitating movement between islands (Belkin et al., 1945). The close relationship between Australia’s Northern Territory and Vanuatu

populations and the Queensland and Guadalcanal populations observed in this study is difficult to explain. A possible explanation may lie in the past geography of the region. During the late

Pliocene, cooling and drying of the planet resulted in lower sea levels greatly altering coastlines and creating a land mass connecting northern Australia with the east–west length of New

Guinea (Kikkawa et al., 1981). These conditions remained up until the Pleistocene and may have facilitated the movement of _An. farauti_ _s.s._ populations eastwards, from northern Australia

into the Solomon Islands and from there into Vanuatu. If this theory is correct then populations of _An. farauti s.s_. from the western side of its range, i.e. western New Guinea and the

Moluccas, should also have genotypes similar to the northern Australian genotypes. RDNA IN POPULATION GENETICS The architecture of the rDNA unit has been well studied, especially with

respect to Culicidae genetics (reviewed by Collins & Paskewitz, 1996). The rDNA array evolves co-ordinately within a species through a process of concerted evolution and is believed to

be the result of a number of DNA replication and repair mechanisms driven by sequence homogenizing machinery such as gene conversion, gene amplification and unequal crossover between

repeated units (Dover, 1982). To maintain sequence integrity between rDNA repeat units in a multigene family, sequence homogenizing and repair mechanisms may require recombination events

between the rDNA repeat units within or between chromosomes. Thus, within an interbreeding popula- tion these sequences are either homogenized or in the process of homogenization. For

homogenization to occur, concerted evolution must exceed the rate of new mutations or the introduction of variant sequences through hybridization of foreign ITS sequences. Thus, an

interbreeding population or species may fix sequence variants appearing in the rDNA unit. Unequal crossover and gene conversion allows sequence and length variation to become established or

fixed in the gene family within an interbreeding population or species (Schlotterer & Tautz, 1994). The mechanisms involved are not fully understood and may in fact vary within different

organisms. Recent studies though on _Drosophila melanogaster_ by Polanco et al. (1998) may provide insights into the evolution of these mosquitoes. These studies suggest that IGS size

variants observed in _D_. _melanogaster_ are probably caused by interchromosomal exchanges. Moreover, Schlotterer & Tautz (1994) suggested that homogenization of ITS variants was

occurring along separate chromosomes or lineages and that selection and/or drift was responsible for fixation of new homogenized arrays, thus displaying a single lineage model of

homogenization. Most populations of _An. farauti s.s._ did not display homogenized ITS sequences. Moreover, the colony mosquitoes originally from Rabaul have undergone hundreds of

generations of intense interbreeding without homogenizing the ITS sequence variants and may possibly require thousands more generations for homogenization to occur. Another explanation for

this observation is that the rDNA array occupies more than one locus on nonhomologous chromosomes, preventing any interlocus recombination and thus the independent evolution of two rDNA gene

families. Moreover, the presence of NT-ITS1 sequences in certain QLD/WP populations (presence of a 180-bp band in Fig. 3, sites 11–14) combined with the HDA data that consistently showed

the same two ITS2 sequences in all mosquitoes of this genotype, is difficult to explain and may suggest that recombination events have occurred between rDNA units containing the same ITS2

sequence and different ITS1 sequences, or that interchromosomal exchanges are occurring at the ITS1 and not the ITS2. Confirmation of the mechanisms involved will require physical mapping of

chromosomes to localize the rDNA array. Nevertheless, _in situ_ hybridization studies using rDNA probes on mitotic mosquito chromosomes have localized the rDNA array to a single haploid

chromosome in 19 of 20 species of mosquito across eight genera (Kumar & Rai, 1990). Two anophelines have been physically mapped for the rDNA array (_An. quadrimaculatus_ and _An.

gambiae_) and in both cases the rDNA array was localized to a single locus on the sex chromosomes (Collins et al., 1987; Kumar & Rai, 1990). Thus it is likely that the _An. farauti s.s._

rDNA array exists at a single locus and that intrachromosomal exchanges are occurring to the ITS1. The ITS1 and ITS2 regions are only physically separated by a few hundred nucleotides, yet,

as observed in this study, appear to display different levels of sequence variation. Preliminary sequence data from the ITS1 identified it as being highly polymorphic containing several

(CA)_n_ dinucleotide microsatellite repeats possibly contributing this region’s polymorphic nature (unpubl. data). The true function of these spacers remains vague, seemingly based on

hydrogen-bonded secondary structures which, when modified slightly in conserved regions or modified considerably in variable regions, hinder maturation of the mature rRNA product (van der

Sande et al., 1992). Analysis of the ITS2 sequences between the cryptic species in the _An. punctulatus_ group showed considerable sequence variation between species (2.3% to 24.3%), most of

which occurred as insertion/deletion indels and resulted in considerable differences in the secondary structures (Beebe et al., 1999). What is the evolutionary significance of molecular

drive on these rDNA spacer sequences in interbreeding populations and how useful will molecular drive be in the study of population movement and structure? In the case of _An. farauti_

_s.s_., it seems informative in the study of species-level evolution (Beebe & Saul, 1995; Beebe et al., 1999). Furthermore, these spacers are useful for within-species comparisons,

facilitating the identification of distinct genotypes demonstrating a macrogeographical distribution and hybridization boundaries. Because this mosquito species is restricted to coastal

regions, visualization of biogeographical dispersal showed a linear distribution along the mainland coastal regions. Moreover, it does appear that an individual in an interbreeding

population reflects the rDNA status of the population and thus less individual sampling may be permitted to identify the genetic status of populations. In addition, identification of the

genetic complexity of sequence variants in the rDNA array may disclose species origin. It seems the rDNA spacer provides a useful marker to study population structure and in turn the

machinery of concerted evolution. REFERENCES * Appawu, M. A., Baffoe-Wilmot, A., Afari, E. A., Nkrumah, F. K. and Petrarca, V. (1994). Species composition and inversion polymorphism of the

_Anopheles gambiae_ complex in some sites of Ghana, West Africa. _Acta Tropica_, 56: 15–23. Article  CAS  Google Scholar  * Beebe, N. W. and Saul, A. (1995). Discrimination of all members of

the _Anopheles punctulatus_ complex by polymerase chain reaction-restriction fragment length polymorphism analysis. _Am J Trop Med Hyg_, 53: 478–481. Article  CAS  Google Scholar  * Beebe,

N. W., Ellis, J. T., Cooper, R. D. and Saul, A. (1999). DNA sequence analysis of the ribosomal DNA ITS2 region for the _Anopheles punctulatus_ group of mosquitoes. _Insect Mol Biol_, 8:

381–390. Article  CAS  Google Scholar  * Belkin, J. N., Knight, K. L. and Rozeboom, L. E. (1945). Anopheline mosquitoes of the Solomon Islands and New Hebrides. _J Parasitol_, 31: 241–265.

Article  Google Scholar  * Charlwood, J. D., Dagoro, H. and Paru, R. (1985). Blood-feeding and resting behaviour in the _Anopheles punctulatus_ Donitz complex (Diptera: Culicidae) from

Coastal Papua New Guinea. _Bull Ent Res_, 75: 463–475. Article  Google Scholar  * Collins, F. H. and Paskewitz, S. (1996). A review of the use of ribosomal DNA (rDNA) to differentiate among

cryptic _Anopheles_ species. _Insect Mol Biol_, 5: 1–9. Article  CAS  Google Scholar  * Collins, F. H., Mendez, M. A., Rasmussen, M. O., Mehaffy, P. C., Besansky, N. J. and Finnerty, V.

(1987). A ribosomal RNA gene probe differentiates member species of the _Anopheles gambiae_ complex. _Am J Trop Med Hyg_, 37: 37–41. Article  CAS  Google Scholar  * Coluzzi, M., Sabatini,

A., Petrarca, V. and Dideco, M. A. (1979). Chromosomal differentiation and adaptation to human environments in the _Anopheles gambiae_ complex. _Trans R Soc Trop Med Hyg_, 73: 483–497.

Article  CAS  Google Scholar  * Cooper, R. D., Frances, S. P. and Sweeney, A. W. (1995). Distribution of members of the _Anopheles farauti_ complex in the Northern Territory of Australia. _J

Am Mosq Control Ass_, 11: 66–71. CAS  Google Scholar  * Cooper, R. D., Frances, S. P., Waterson, D. G. E., Piper, R. G. and Sweeney, A. W. (1996). Distribution of anopheline mosquitoes in

north Australia. _J Am Mosq Control Assoc_, 12: 656–663. CAS  PubMed  Google Scholar  * Cooper, R. D., Waterson, D. G. E., Kupo, M., Foley, D. H., Beebe, N. W. and Sweeney, A. W. (1997).

Anopheline mosquitoes of the Western Province of Papua New Guinea. _J Am Mosq Control Ass_, 13: 5–12. CAS  Google Scholar  * Cranston, P. S. and Naumann, I. D. (1991). Biogeography. In:

Newman, I. D. (ed.) _The Insects of Australia_, 2nd edn, vol. 1, pp. 180–197. Melbourne University Press, Victoria, Australia. Google Scholar  * Dover, G. A. (1982). Molecular drive: a

cohesive mode of species evolution. _Nature_, 299: 111–117. Article  CAS  Google Scholar  * Favia, G., Dellatorre, A., Bagayoko, M., Lanfrancotti, A., Sagnon, N. F. and Toure, Y. T. _et al_

(1997). Molecular identification of sympatric chromosomal forms of _Anopheles gambiae_ and further evidence for the reproductive isolation. _Insect Mol Biol_, 6: 377–383. Article  CAS 

Google Scholar  * Fenton, B., Malloch, G. and Moxey, E. (1997). Analysis of eryphyid mite rDNA internal transcribed spacer sequences reveals variable simple sequence repeats. _Insect Mol

Biol_, 6: 23–32. Article  CAS  Google Scholar  * Foley, D. H., Meek, S. R. and Bryan, J. H. (1994). The _Anopheles punctulatus_ group of mosquitoes in the Solomon Islands and Vanuatu

surveyed by allozyme electrophoresis. _Med Vet Entomol_, 8: 340–350. Article  CAS  Google Scholar  * Kikkawa, J., Monteith, G. B. and Ingram, G. (1981). Cape York Peninsula: major region of

faunal interchange. In: Keast, A. (ed.) _Ecological Biogeography of Australia_, vol. 3, pp. 1697–1736. Dr W. Junk, The Hague. Google Scholar  * Kumar, A. and Rai, K. S. (1990). Chromosomal

localization and copy number of 18S+28S ribosomal RNA genes in evolutionary diverse mosquitoes (Diptera, Culicidae). _Hereditas_, 113: 277–289. Article  CAS  Google Scholar  * Mcalpine, J.

R., Keig, G. and Falls, R. (1983). _Climate of Papua New Guinea_. Australian National University Press, Canberra, Australia. Google Scholar  * Miller, B. R., Crabtree, M. B. and Savage, H.

(1996). Phylogeny of fourteen C_ulex_ mosquito species including the _Culex pipiens_ complex, inferred from the internal transcribed spacer of ribosomal DNA. _Insect Mol Biol_, 5: 93–107.

Article  CAS  Google Scholar  * Mnzava, A. E. P., Mutinga, M. J. and Staak, C. (1994). Host blood and chromosomal inversion polymorphism in _Anopheles arabiensis_ in the Baringo District of

Kenya. _J Am Mosq Control Assoc_, 10: 507–510. CAS  PubMed  Google Scholar  * Petrarca, V. and Beier, J. C. (1992). Intraspecific chromosomal polymorphism in the _Anopheles gambiae_ complex

as a factor affecting malaria transmission in the Kisumu area of Kenya. _Am J Trop Med Hyg_, 46: 229–237. Article  CAS  Google Scholar  * Polanco, C., Gonzalez, A. I., Delafuente, A. and

Dover, G. A. (1998). Multigene family from ribosomal DNA in _Drosophila melanogaster_ reveals contrasting patterns of homogenization for IGS and ITS spacer regions: a possible mechanism to

resolve this paradox. _Genetics_, 149: 243–256. CAS  PubMed  PubMed Central  Google Scholar  * Roberts, F. H. S. (1948). The distribution and seasonal prevalence of anopheline mosquitoes in

north Queensland. _Proc R Soc Qld_, 59: 93–100. Google Scholar  * Russell, R. C. and Whelan, P. I. (1986). Seasonal prevalence of adult mosquitoes at Casuarina and Leanyer, Darwin. _Aust J

Ecol_, 11: 99–105. Article  Google Scholar  * Schlotterer, C. and Tautz, D. (1994). Chromosomal homogeneity of _Drosophila_ ribosomal DNA arrays suggest intrachromosomal exchanges drive

concerted evolution. _Curr Biol_, 4: 777–783. Article  CAS  Google Scholar  * Sweeney, A. W. (1987). Larval salinity tolerances of the sibling species of _Anopheles farauti_. _J Am Mosq

Control Ass_, 3: 589–592. CAS  Google Scholar  * Tang, J. and Unnasch, T. R. (1997). Heteroduplex analysis in medical entomology: a rapid and sensitive sequence-based tool for population and

phylogenetic studies. _Parasitol Today_, 13: 271–274. Article  CAS  Google Scholar  * Tang, J. M., Toe, L., Black, C. and Unnasch, T. R. (1996). Intraspecific heterogeneity of rDNA internal

transcribed spacer in the _Simulium damnosum_ (Diptera: Simulidae) complex. _Mol Biol Evol_, 13: 244–252. Article  CAS  Google Scholar  * Vandersande, C. A., Kwa, F. M., Vannues, R. W.,

Vanheerikhuizen, H., Raue, H. A. and Planta, R. J. (1992). Functional analysis of internal transcribed spacer 2 of _Saccharomyces cerevisiae_ ribosomal DNA. _J Mol Biol_, 233: 899–910.

Article  Google Scholar  * Wesson, D. M., Porter, C. H. and Collins, F. H. (1992). Sequence and secondary structure comparisons of ITS rDNA in mosquitoes (Diptera: Culicidae). _Mol Phy

Evol_, 1: 253–269. Article  CAS  Google Scholar  Download references ACKNOWLEDGEMENTS The authors would like to thank Darren Waterson and Steven Frances for assistance in the collection of

field material. This paper was published with the approval of the Director General of Defence Health Services. This work was supported by the Australian Research Council. AUTHOR INFORMATION

AUTHORS AND AFFILIATIONS * Department of Cell and Molecular Biology, Molecular Parasitology Unit, University of Technology, Sydney, 2065, Gore Hill, Australia Nigel W Beebe & John T

Ellis * Australian Army Malaria Institute, Gallipoli Barracks, Enoggera, 4052, Queensland, Australia R D Cooper * Tropical Health Programme and Department of Zoology and Entomology,

University of Queensland, 4072, Australia Desmond H Foley Authors * Nigel W Beebe View author publications You can also search for this author inPubMed Google Scholar * R D Cooper View

author publications You can also search for this author inPubMed Google Scholar * Desmond H Foley View author publications You can also search for this author inPubMed Google Scholar * John

T Ellis View author publications You can also search for this author inPubMed Google Scholar CORRESPONDING AUTHOR Correspondence to Nigel W Beebe. RIGHTS AND PERMISSIONS Reprints and

permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Beebe, N., Cooper, R., Foley, D. _et al._ Populations of the south-west Pacific malaria vector _Anopheles farauti s.s._ revealed by ribosomal

DNA transcribed spacer polymorphisms. _Heredity_ 84, 244–253 (2000). https://doi.org/10.1046/j.1365-2540.2000.00665.x Download citation * Received: 13 November 1998 * Accepted: 02 November

1999 * Published: 01 February 2000 * Issue Date: 01 February 2000 * DOI: https://doi.org/10.1046/j.1365-2540.2000.00665.x SHARE THIS ARTICLE Anyone you share the following link with will be

able to read this content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing

initiative KEYWORDS * _Anopheles farauti_ * concerted evolution * ITS2 * malaria * mosquito * rDNA