ABSTRACT Autoimmune lymphoproliferative syndrome (ALPS) is characterized by autoimmune features and lymphoproliferations and is generally caused by defective Fas-mediated apoptosis. This

report describes a child with clinical features of ALPS without detectable Fas expression on freshly isolated blood leukocytes. Detection of _FAS_ transcripts via real-time quantitative PCR

made a severe transcriptional defect unlikely. Sequencing of the _FAS_ gene revealed a 20-nucleotide duplication in the last exon affecting the cytoplasmic signaling domain. The patient was

homozygous for this mutation, whereas the consanguineous parents and the siblings were heterozygous. The patient reported here is a human homologue of the Fas-null mouse, inasmuch as she

DEVELOPMENT OF AUTOIMMUNE LYMPHOPROLIFERATIVE SYNDROME Article Open access 04 May 2024 A HUMAN CASE OF GIMAP6 DEFICIENCY: A NOVEL PRIMARY IMMUNE DEFICIENCY Article 16 December 2020

SINGLE-CELL ANALYSIS OF FOXP3 DEFICIENCIES IN HUMANS AND MICE UNMASKS INTRINSIC AND EXTRINSIC CD4+ T CELL PERTURBATIONS Article 08 April 2021 MAIN ALPS is characterized by lymphadenopathy,

splenomegaly, accumulation of nonmalignant CD4−CD8−TCRαβ+ T cells, and several autoimmune features, such as autoantibody production and autoimmune hemolytic anemia (1). It is caused by a

defect in apoptosis mediated by Fas (also designated CD95, Apo1, or Apt1). ALPS features are highly comparable to the phenotype of mice with _lpr_ or _gld_ mutations, which carry an

autosomal recessive mutations in the _FAS_ gene or in the gene encoding Fas ligand (_FASL)_, respectively, causing autoimmunity, lymphoproliferations and accumulation of CD4−CD8−TCRαβ+ T

cells (2–4). There are three mouse strains carrying different _FAS_ mutations _i.e._ the _lpr_, the _lpr_cg and the Fas-null strains (2, 5). Although these mice have a similar phenotype,

there are differences in severity and the time of development of the symptoms (6). Both FasL and Fas are transmembrane proteins, which belong to the tumor necrosis factor and tumor necrosis

factor receptor family, respectively (7, 8). Fas is expressed as a trimer on peripheral activated lymphocytes and also in tissues such as liver, lung, heart, and ovary. The intracellular

part of the Fas protein contains a death domain, which is essential for the induction of apoptosis on interaction of Fas and FasL trimers (9). Fas-mediated apoptosis is needed for the

elimination of autoreactive T lymphocytes that escaped thymic selection, but seems not to be involved in negative selection of immature cells in the thymus (10–12). The Fas-FasL interaction

also appears to be important in B cell homeostasis and is involved in the control of immune responses (13, 14). A soluble form of Fas without the transmembrane domain (FasΔTM) has been shown

to be capable of inhibiting Fas-mediated apoptosis by blocking membrane bound FasL _in vitro_ (15). The human _FAS_ gene consists of 9 exons and is located on chromosome 10 (16–18). The

patients with ALPS that have been described thus far show largely comparable clinical features, with variation in severity (1, 19–24). We herein present a new patient in whom Fas protein

expression studies were followed by extensive molecular analysis of the _FAS_ gene of the patient as well as her parents and siblings. The unique genotype and phenotype of this patient are

discussed in the context of previously described patients with ALPS and the different mouse strains with distinct _FAS_ gene mutations. METHODS CLINICAL REPORT. The patient is a girl from

consanguineous parents. She has three healthy siblings, but two other siblings died at the ages of 1.5 and 2 y. Immediately after the girl's birth, petechiae, generalized edema, and

hepatosplenomegaly were noticed. During the first month of life, autoantibodies against red blood cells and platelets were demonstrated. A liver biopsy showed extensive extramedullary

hematopoiesis. In PB-MNC, a high percentage (15%) of CD4−CD8−TCRαβ+ T cells was observed. Hypergammaglobulinemia (IgG, 13.8 g/L; IgM, 0.85 g/L; IgA, 2.48 g/L) remained persistent for several

years. At the age of 8 mo, she had massive generalized adenopathy of the cervical, mesenterial, and para-aortal lymph nodes and chronic pulmonary disease not responding to bronchodilation

and not associated with detection of pathogens. Flow cytometric immunophenotyping of PB-MNC and lymph node biopsy specimens indicated that 30% and 70% of cells, respectively, were

CD4−CD8−TCRαβ+ T cells. Figure 1_A_ shows the T lymphoblast infiltration in the lymph node. Lymphoproliferative responses to the mitogens PHA, ConA, PWM, ProtA, and SAC, and the CD3 (OKT3)

antibody indicated no functional T and B cell impairment. Analysis of a lymph node biopsy was suggestive of a T cell non-Hodgkin's lymphoma, but _TCRB_ analysis did not show monoclonal

or oligoclonal rearrangements. Skin biopsy specimens taken during relapse showed IgM and complement depositions in the dermis consistent with lupus-like disease. At the same time, rheumatoid

factors (IgM and IgA) as well as autoantibodies against nuclear antigens, smooth muscle, striated muscle, and neutrophil cytoplasmic antigens were demonstrated in serum. Subsequently, the

girl remained in a stable condition without hemolytic anemia, and her pulmonary function improved gradually. At the age of 4–5 y, she had maculopapular to nodular skin abnormalities on the

face and on both arms and legs. Clinically this skin disease resembled mycosis fungoides. Skin biopsies showed the histopathologic aspects of malignant cutaneous T cell lymphoma (Fig. 1_B_).

Approximately 30% of T cells in the dermal infiltrates were CD3+CD4+CD8−. DNA analysis showed biallelic _TCRB_ gene rearrangements in one of the biopsy specimens, but not in others, making

mycosis fungoides less likely. A bone marrow biopsy did not reveal abnormal T cells. Immunophenotyping of PB-MNC yielded normal results. The girl was diagnosed with ALPS and during the

following years she became increasingly ill. Her lung disease required continuous oxygen administration. The paresis of the right arm and diaphragm persisted, whereas the cutaneous symptoms

had a chronically intermittent course. She finally died at the age of 8 y as a result of pulmonary failure. BLOOD SAMPLES AND DNA AND RNA EXTRACTION. PB samples from the patient, her

parents, and three healthy siblings, as well as from healthy control subjects were obtained. MNC were isolated from PB by Ficoll density centrifugation (Ficoll-Paque; density, 1.077 g/mL;

Pharmacia, Uppsala, Sweden). After Ficoll density centrifugation, both MNC and granulocyte fractions were used for DNA extraction with the phenol-chloroform method and for RNA extraction

using the method according to Chomczynski and Sacchi (25). IMMUNOPHENOTYPING. Double and triple flow cytometric immunophenotyping was performed to study Fas (CD95) expression on

granulocytes, monocytes, and CD4+CD3+, CD8+CD3+, CD45RO+CD3+, and CD45RA+CD3+ T lymphocyte subpopulations. For this purpose, 50 μL of whole blood or MNC was incubated with 50 μL of various

combinations of FITC, phycoerythrin, and phycoerythrin-cyanin-5 conjugated with CD95 (UB-2 and CH11; Immunotech, Marseille, France), CD95 (DX-2; PharMingen, San Diego, CA), CD95 (7C11;

Beckman Coulter, Fullerton, CA), CD3 (HIT3a), CD4 (Leu-3a), CD8 (Leu-2a), CD45RO (UCHL1; Becton Dickinson, San Jose, CA), and CD45RA (2H4; Coulter Clone, Hialeah, FL) antibodies for 10 min

at room temperature. After incubation, the cells were washed, and, in the case of whole blood, the erythrocytes were lysed with lysing solution (Becton Dickinson). Appropriate isotype

controls were performed in every test. To quantitate the density of Fas expression in terms of numbers of molecules of equivalent soluble fluorochrome, the fluorescence intensity was

calibrated using Quantum FITC premixed microbead standards (Flow Cytometry Standard Corp., San Juan, PR). To investigate Fas expression on stimulated T lymphocytes, PB-MNC were cultured (0.5

× 106 cells/mL) in RPMI 1640 medium with Glutamax-I, supplemented with 100 U/mL penicillin, 100 μg/mL streptomycin, and 10% FCS in the presence of PHA (0.2 μg/mL). The cells were maintained

for 7 d at 37°C in a humidified atmosphere of 5% CO2 in air. Fas expression was evaluated daily with triple immunostainings as described above. RT-PCR AND RQ-PCR. cDNA was prepared from

mRNA using AMV reverse transcriptase (Promega, Madison, WI). RT-PCR was performed with different combinations of the cDNA primers EU, ED, CU and CD (see Fig. 4) to amplify parts of the

coding region (EU: CTGGGAATTCCTACCTCTGGTTCTTACGTCTG, ED: CATGAATTCATCAAGGAATGCACACTCACC, CU: TGAGAAGCTTGGTTTTCCTTTCTGTG, CD: CTAGACCAAGCTTGGATTTCATTTC). RT-PCR conditions were 1 min at 94°C,

1 min at 60°C, and 2 min at 72°C for 35 cycles. The PCR products were separated on a 6% polyacrylamide gel. For the quantification of _FAS_ mRNA, we performed RQ-PCR with ABI Prism 7700

Sequence Detection (PE Biosystems, Foster City, CA) (26). Two _FAS_ primers and a _Taq_ Man probe were designed with the ABI Prism Primer Express (PE Biosystems) (FASTM5′:

TCCTCAAGGACATTACTAGTGACTCAG, FASTM3′: ATCTTTTCAAACACTAATTGCATATACTCAG, FAS _Taq_ Man probe labeled with FAM reporter dye: GAAATCCAAAGCTTGGTCTAGAGTGAAAAACAAC). During the PCR the _Taq_ Man

probe first hybridizes to the DNA target, followed by primer annealing. The emission of the reporter dye of the _Taq_ Man probe is quenched until the probe is cleaved by the exonuclease

activity of the _Taq_ polymerase, generating a fluorescent reporter signal. The RQ-PCR conditions were 2 min at 50°C for the AmpErase Uracil _N_-glycosylase step, 10 min at 95°C to activate

Ampli _Taq_ Gold, followed by 50 cycles of 15 s at 95°C and 1 min at 60°C. _Taq_ Man GAPDH control reagents (PE Biosystems) were used to quantify the amount of cDNA in the reaction. PCR OF

GENOMIC DNA AND HETERODUPLEX ANALYSIS. For amplification of genomic DNA, nine primer sets were designed to amplify each of the nine exons. All primers were positioned in the introns, at

least 25 base pairs upstream or downstream of the splice sites of the involved exons. The conditions for PCR analysis of genomic DNA were essentially the same as for the RT-PCR method. PCR

products were further analyzed by heteroduplex analysis to detect potential differences between the exons of the two alleles. After denaturation (5 min at 94°C) and renaturation (1 h at

4°C), the resulting duplexes (hetero- and/or homoduplexes) were separated in nondenaturing 6% polyacrylamide gels (27). SOUTHERN BLOT ANALYSIS. Genomic DNA samples of 20 μg were digested

with _Eco_ RI, _Bam_ HI, _Hin_ dIII, or _Sac_ I. The restriction fragments were separated in 0.7% agarose gels, transferred to Nytran-13N nylon membranes (Scheichler and Schuell, Dassel,

Germany), and hybridized with exon 1, exon 3, and exon 9 probes (28). The probes were generated by PCR amplification of the exons using MNC DNA from a healthy individual and radioactively

labeled with [α-32P]dATP and [α-32P]dCTP using the random primer labeling method. SEQUENCE ANALYSIS. The products of both RT-PCR and genomic PCR amplification were sequenced with the T7

Sequence Kit (Pharmacia) using 35S radiolabeling after cloning in pMosBlue (Amersham Int., Amersham, UK), and the fragments were run in a denaturing 8% polyacrylamide sequence gel. Exons

were also analyzed by cycle sequencing on the ABI 373 fluorescent sequencer (PE Biosystems). RESULTS FAS PROTEIN EXPRESSION. In contrast to healthy children and adults, the granulocytes,

monocytes, and CD45RO+ T lymphocytes of the patient did not express detectable levels of Fas protein (Fig. 2_A_). The absence of Fas expression on MNC of the patient was confirmed with three

different CD95 antibodies (data not shown). Two family members showed intermediate Fas protein expression (Fig. 2_B_), but they did not show any of the clinical features. Furthermore,

PB-MNC were stimulated _in vitro_ with PHA to induce Fas protein expression on activated and proliferating T lymphocytes. As expected, within 2 d of culture, virtually all MNC of healthy

control subjects expressed Fas (Fig. 3_A_). Maximum levels of Fas density per cell were reached after 4 to 5 d of culture (Fig. 3_B_). In contrast, only a small fraction of the

patient's MNC (10–20%) expressed Fas at low density levels, which were 5 to 6-fold lower than in healthy control subjects (Fig. 3). RT-PCR ANALYSIS OF _FAS_ MRNA. The observation that

_FAS_ RT-PCR products could be generated with the four primers EU, ED, CU, and CD (Fig. 4_A_) indicated that _FAS_ mRNA was expressed in leukocytes from the patient. cDNA amplification with

the ED and CD primers, which are located in the extracellular and cytoplasmic regions, respectively, should generate two products: one including and one excluding the transmembrane region

(Fig. 4_A_). Both in the healthy control subjects and in the patient, two PCR products were obtained, indicating that both splice variants were present. However, the two products of the

patient were found to be larger compared with those of healthy control subjects (Fig. 4_B_). This suggested that there may be a defect in the cytoplasmic region. QUANTIFICATION OF _FAS_ MRNA

BY RQ-PCR. RQ-PCR was subsequently performed to determine whether the amount of _FAS_ mRNA in MNC of the patient was comparable to that of healthy control subjects. In RQ-PCR, the CT is a

measure of the amount of template present in the sample. A GAPDH housekeeping gene control reaction was performed to check for the amount of cDNA in the reaction mixture, which was found to

be equal (similar CT values) in the patient and the two healthy control subjects (Fig. 5_A_). Figure 5_B_ shows that the amount of _FAS_ mRNA in the patient equals the amount present in the

healthy control subjects, as evidenced from the similar CT values. HETERODUPLEX PCR ANALYSIS AND SEQUENCING OF _FAS_ EXONS. All _FAS_ exons were amplified using intron primers, and the

resulting PCR products were subjected to heteroduplex analysis to find possible allelic differences. Heteroduplex analysis is based on denaturation and renaturation of the PCR products,

leading to the formation of one homoduplex in a homozygous situation and two homoduplexes as well as two heteroduplexes in a heterozygous situation. Homo- and heteroduplexes can be separated

by PAGE on the basis of the differences in conformation. Heteroduplexes are more retarded in a polyacrylamide gel because of mismatches or bulging loops. At low renaturation temperatures

(<20°C) some single-strand PCR products will remain that have a different (generally lower) mobility compared with heteroduplexes in gel electrophoresis. Using this assay for PCR products

derived from exons 1 to 8, only homoduplexes and no heteroduplexes were found in the patient, her family members, and healthy control subjects. Moreover, in these exons, no size differences

were found between patient, siblings, and control subjects (data not shown). However, the homoduplexes of the PCR products of exon 9 of the patient and control subjects showed a difference

in size similar to that seen with the ED and CD primers in the RT-PCR analysis (Fig. 6, _A_ and _B_), suggesting that the patient was homozygous for a larger exon 9 product. Hemizygosity of

the _FAS_ gene in the patient was excluded, because Southern blot analysis showed equal band intensities in the patient and control subjects, suggesting the presence of two _FAS_ alleles

without major deletions or rearrangements (data not shown). In the family members, we identified two homoduplexes, representing the allele with the normal and the one with the larger exon 9

product, as well as two heteroduplexes, representing cross-annealed single-strand fragments of the two alleles (Fig. 6_B_). These findings were further supported by the presence of two

single-strand bands in the lanes of samples from the patient and control subject, which represent the coding and noncoding fragments of the homozygous alleles. In the lanes of samples from

the family members, three single-stranded bands were observed, representing the coding and noncoding fragments of the two different alleles, two of which probably comigrated (Fig. 6_B_).

Sequencing of _FAS_ exon 9 revealed a duplication of 20 nucleotides (Fig. 6_C_). In the cDNA, the same mutation was found. This duplication causes a frameshift resulting in an extended

predicted protein (Fig. 6_D_). The six C-terminal amino acids (Glu-Ile-Gln-Ser-Leu-Val) are replaced by 37 amino acids. The second and third amino acids in the altered reading frame are not

changed as a result of the duplication. Sequencing of all other exons revealed no additional mutations. DISCUSSION The patient reported here developed the classic features of ALPS

immediately after birth. She showed all phenotypic characteristics, including cutaneous lupus-like disease at a later stage. Moreover, the patient showed histologically malignant lymph

nodes, although monoclonal or oligoclonal rearrangements could not be detected on _TCRB_ gene analysis. Both the early onset and the extensiveness of the ALPS characteristics suggest that

the phenotype of the reported patient was very severe compared with other patients with ALPS that have previously been described (Table 1). The consanguineous parents and siblings of the

patient did not show these autoimmune features and lymphoproliferations. Immunophenotyping demonstrated that leukocytes of the patient did not show detectable levels of Fas protein, whereas

the expression on leukocytes of the family members was intermediate. _In vitro_ stimulation of PB-MNC resulted in low levels of Fas expression on only a minor fraction of the proliferating T

cells. This suggests that Fas protein can potentially be expressed, but only with strong stimuli _in vitro_. Molecular analysis was performed to determine the genotype of the patient.

RT-PCR data showed that both the _FAS_ and _FASΔTM_ splice variants were present, although they were enlarged in the region encoding the cytoplasmic part of the protein. Quantitative mRNA

analysis with RQ-PCR showed that the same amount of _FAS_ mRNA was present in the patient compared with the healthy control subjects. This made a transcriptional defect unlikely.

Heteroduplex PCR analysis of the _FAS_ gene exons and sequencing analysis showed that the patient had a homozygous duplication of 20 bp in the death domain encoding exon 9. The patient is

most probably not hemizygous for this mutation, because Southern blot analysis of the patient did not show any abnormality compared with healthy control subjects and family members. The

duplication introduces a frameshift resulting in a longer predicted protein, which might be less stable or defective in proper transport to the cell surface. Both parents and siblings were

heterozygous for this mutation and did not show typical ALPS features. Therefore, this patient carries a unique homozygous recessive mutation in the _FAS_ gene. All previously described

patients with ALPS are phenotypically largely comparable as is shown in Table 1. However, considerable differences are found in severity, age of onset, and in the presence or absence of some

specific characteristics. All patients showed lymphoproliferations, but the manifestation of the autoimmune features varied. Even siblings or other family members carrying the same mutation

(patients 1a and b, patients 10 a, b, and c, and patients 13 a, b, and c) showed differences in the extent of autoimmune features (19, 21, 23). In _lpr_ and _lpr_cg mice, _FAS_ mutations

result in lymphoproliferations, whereas autoimmunity in these mice is strongly influenced by the genetic background (29). The collective patient data suggest that also in man genetic

background might influence the clinical manifestation of autoimmune features. On the basis of different genotypes, three groups of patients with ALPS can be distinguished. The first group

includes patients with a heterozygous _FAS_ mutation (patients 1–10 in Table 1), suggesting a dominant-negative defect in Fas-mediated apoptosis. Healthy family members of these patients

with ALPS who have a heterozygous _FAS_ mutation showed defects in _in vitro_ Fas-mediated apoptosis without clearly showing the clinical symptoms, although some of the family members of

patients 3, 4, 6, and 10 in Table 1 did show a few ALPS symptoms. In case a particular mutation does not cause clinical symptoms in the family members, it might well be that the involved

_FAS_ mutation is not the single cause of ALPS in these children. It is likely that another defect, for example affecting FasL or downstream signaling molecules of Fas-mediated apoptosis, is

inherited from the parent without the _FAS_ gene defect. Candidates for Fas-mediated signaling defects are proteins that associate with the death domain, such as RIP, FADD, and FLICE

(30–33). One could speculate that in this situation, ALPS may result from a digenic defect. In that case the _FAS_ mutation might be called autosomal recessive, although this can formally

only be proven in a clinically symptomatic individual showing the homozygous _FAS_ mutation. It remains unclear whether another defect is also present in heterozygous family members showing

only a few clinical symptoms of ALPS. So far, symptomatic heterozygous Fas-deficient mice have not been described. A second group of patients with ALPS (patients 11-13 in Table 1) is

associated with biallelic recessive mutations. In these patients, both alleles are affected, whereas heterozygous family members do not show clinical symptoms. Our patient reported here

(patient 11) carries the same mutation on both alleles and is therefore homozygous for this recessive _FAS_ gene mutation. Recessive mutations are also found in the _lpr_, _lpr_cg, and

Fas-null mice. _Lpr_ mice having a transposon in intron 2 are able to express low levels of normal _FAS_ mRNA, implying that they are not completely deficient for Fas. _Lpr_cg mice express

Fas protein on the membrane, although this protein is not functional because of one amino acid substitution. Fas-null mice are completely Fas protein deficient and display the same phenotype

as _lpr_ mice, but the phenotype is more severe and accelerated in presentation. Fas-null mice also have liver cell hyperplasia, which is not seen in _lpr_ and _lpr_cg mice (5). Therefore,

it is clear that the type of _FAS_ gene mutation determines the level of (aberrant) protein expression and thereby influences the severity of the phenotype. The patient studied in this

report (patient 11) carries a homozygous mutation affecting the cytoplasmic tail of the protein. This mutation severely affects Fas protein expression. Patient 12 also lacks Fas expression

because of a homozygous deletion of the last 290 bp. Both patients had ALPS from birth on and showed all characteristic ALPS symptoms. It is therefore tempting to compare these human _FAS_

gene mutations with the murine Fas-null mutation, in which deletion of the death domain also affects Fas protein expression. However, the hepatomegaly in our patient was not clearly caused

by liver cell hyperplasia, but was probably caused by erythropoiesis and some swelling of the hepatocytes. There was no striking difference in nuclear sizes in comparison with an age-matched

liver from a girl who died of sudden infant death syndrome. The patients described by Bettinardi _et al._ (21) (patients 13 a, b, and c) also have double mutations, but these concern

different missense point mutations on the two alleles. These mutations do not seem to disturb trimerization, but result in the expression of a Fas trimer on the membrane, which is apparently

not entirely functional. The slightly reduced Fas expression in these patients was explained by reduced density rather than by a conformational change. On the basis of severity, age of

onset, and type of mutation, these patients are phenotypically and genotypically similar to _lpr_cg mice. In addition, yet a third group of patients with ALPS has been reported by Sneller

_et al._ (22) and Dianzani _et al._ (34). These patients show the same clinical features, but do not carry a _FAS_ gene mutation. Probably, a defect in FasL or in the signaling pathway

downstream of Fas, gives rise to deficient Fas-mediated apoptosis. In summary, ALPS is caused by defective Fas-mediated apoptosis related to a monoallelic defect in the _FAS_ gene, possibly

accompanied by an additional defect and thereby potentially recessive, although there are some examples in which dominant inheritance of the _FAS_ gene cannot be excluded. A biallelic defect

in the _FAS_ gene is another possibility for ALPS. The mutation found in the patient studied here clearly demonstrated recessive inheritance of ALPS. The syndrome can also be found in

patients lacking a _FAS_ mutation. The severity of the syndrome as determined by the presence of the typical ALPS characteristics and the age of onset is dependent on the type of mutation.

Decreased levels of trimer Fas expression seem to result in milder ALPS forms, whereas complete absence of the Fas protein as observed in our patient induces the severe ALPS phenotype.

ABBREVIATIONS * ALPS: autoimmune lymphoproliferative syndrome * TCR: T cell receptor * PB: peripheral blood * MNC: mononuclear cells * TCRB: TCRβ gene * RT-PCR: reverse transcriptase PCR *

RQ-PCR: real-time quantitative PCR * GAPDH: glyceraldehyde-3-phosphate dehydrogenase * CT: cycle number in which the fluorescent signal exceeds the threshold value REFERENCES * Fisher GH,

Rosenberg FJ, Straus SE, Dale JK, Middleton LA, Lin AY, Strober W, Lenardo MJ, Puck JM 1995 Dominant interfering Fas gene mutations impair apoptosis in a human autoimmune lymphoproliferative

syndrome. _Cell_ 81: 935–946 Article  CAS  Google Scholar  * Sneller MC, Straus SE, Jaffe ES, Jaffe JS, Fleisher TA, Stetler-Stevenson M, Strober W 1992 A novel

lymphoproliferative/autoimmune syndrome resembling murine lpr/gld disease. _J Clin Invest_ 90: 334–341 Article  CAS  Google Scholar  * Watanabe-Fukunaga R, Brannan CI, Copeland NG, Jenkins

NA, Nagata S 1992 Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. _Nature_ 356: 314–317 Article  CAS  Google Scholar  * Takahashi T, Tanaka

M, Brannan CI, Jenkins NA, Copeland NG, Suda T, Nagata S 1994 Generalized lymphoproliferative disease in mice, caused by a point mutation in the Fas ligand. _Cell_ 76: 969–976 Article  CAS 

Google Scholar  * Adachi M, Suematsu S, Kondo T, Ogasawara J, Tanaka T, Yoshida N, Nagata S 1995 Targeted mutation in the Fas gene causes hyperplasia in peripheral lymphoid organs and liver.

_Nat Genet_ 11: 294–300 Article  CAS  Google Scholar  * Adachi M, Suematsu S, Suda T, Watanabe D, Fukuyama H, Ogasawara J, Tanaka T, Yoshida N, Nagata S 1996 Enhanced and accelerated

lymphoproliferation in Fas-null mice. _Proc Natl Acad Sci USA_ 93: 2131–2136 Article  CAS  Google Scholar  * Itoh N, Yonehara S, Ishii A, Yonehara M, Mizushima S, Sameshima M, Hase A, Seto

Y, Nagata S 1991 The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis. _Cell_ 66: 233–243 Article  CAS  Google Scholar  * Takahashi T, Tanaka M,

Inazawa J, Abe T, Suda T, Nagata S 1994 Human Fas ligand: gene structure, chromosomal location and species specificity. _Int Immunol_ 6: 1567–1574 Article  CAS  Google Scholar  * Gulbins E,

Bissonnette R, Mahboubi A, Martin S, Nishioka W, Brunner T, Baier G, Baier-Bitterlich G, Byrd C, Lang F, Kolesnick R, Altman A, Green D 1995 FAS-induced apoptosis is mediated via a

ceramide-initiated RAS signaling pathway. _Immunity_ 2: 341–351 Article  CAS  Google Scholar  * King LB, Ashwell JD 1994 Thymocyte and T cell apoptosis: is all death created equal?. _Thymus_

23: 209–230 PubMed  Google Scholar  * Osborne BA 1996 Apoptosis and the maintenance of homeostasis in the immune system. _Curr Opin Immunol_ 8: 245–254 Article  CAS  Google Scholar  *

Singer GG, Abbas AK 1994 The Fas antigen is involved in peripheral but not thymic deletion of T lymphocytes in T cell receptor transgenic mice. _Immunity_ 1: 365–371 Article  CAS  Google

Scholar  * Rathmell JC, Cooke MP, Ho WY, Grein J, Townsend SE, Davis MM, Goodnow CC 1995 CD95 (Fas)-dependent elimination of self-reactive B cells upon interaction with CD4+ T cells.

_Nature_ 376: 181–184 Article  CAS  Google Scholar  * Lynch DH, Ramsdell F, Alderson MR 1995 Fas and FasL in the homeostatic regulation of immune responses. _Immunol Today_ 16: 569–574

Article  CAS  Google Scholar  * Cheng J, Zhou T, Liu C, Shapiro JP, Brauer MJ, Kiefer MC, Barr PJ, Mountz JD 1994 Protection from Fas-mediated apoptosis by a soluble form of the Fas

molecule. _Science_ 263: 1759–1762 Article  CAS  Google Scholar  * Behrmann I, Walczak H, Krammer PH 1994 Structure of the human APO-1 gene. _Eur J Immunol_ 24: 3057–3062 Article  CAS 

Google Scholar  * Cheng J, Liu C, Koopman WJ, Mountz JD 1995 Characterization of human Fas gene: exon/intron organization and promoter region. _J Immunol_ 154: 1239–1245 CAS  PubMed  Google

Scholar  * Inazawa J, Itoh N, Abe T, Nagata S 1992 Assignment of the human Fas antigen (FAS) to 10q 24: 1. _Genomics_ 14: 821–822 Article  CAS  Google Scholar  * Rieux-Laucat F, Le Deist F,

Hivroz C, Roberts IA, Debatin KM, Fischer A, de Villartay JP 1995 Mutations in Fas associated with human lymphoproliferative syndrome and autoimmunity. _Science_ 268: 1347–1349 Article  CAS

  Google Scholar  * Le Deist F, Emile JF, Rieux-Laucat F, Benkerrou M, Roberts I, Brousse N, Fischer A 1996 Clinical, immunological, and pathological consequences of Fas-deficient

conditions. _Lancet_ 348: 719–723 Article  CAS  Google Scholar  * Bettinardi A, Brugnoni D, Quiros-Roldan E, Malagoli A, La Grutta S, Correra A, Notarangelo LD 1997 Missense mutations in the

Fas gene resulting in autoimmune lymphoproliferative syndrome: a molecular and immunological analysis. _Blood_ 89: 902–909 Article  CAS  Google Scholar  * Sneller MC, Wang J, Dale JK,

Strober W, Middelton LA, Choi Y, Fleisher TA, Lim MS, Jaffe ES, Puck JM, Lenardo MJ, Straus SE 1997 Clinical, immunologic, and genetic features of an autoimmune lymphoproliferative syndrome

associated with abnormal lymphocyte apoptosis. _Blood_ 89: 1341–1348 Article  CAS  Google Scholar  * Infante AJ, Britton HA, DeNapoli T, Middelton LA, Lenardo MJ, Jackson CE, Wang J,

Fleisher T, Straus SE, Puck JM 1998 The clinical spectrum in a large kindred with autoimmune lymphoproliferative syndrome caused by a Fas mutation that impairs lymphocyte apoptosis. _J

Pediatr_ 133: 629–633 Article  CAS  Google Scholar  * Lim MS, Straus SE, Dale JK, Fleisher TA, Stetler-Stevenson M, Strober W, Sneller MC, Puck JM, Lenardo MJ, Elenitoba-Johnson KS, Lin AY,

Raffeld M, Jaffe ES 1998 Pathological findings in human autoimmune lymphoproliferative syndrome. _Am J Pathol_ 153: 1541–1550 Article  CAS  Google Scholar  * Chomczynski P, Sacchi N 1987

Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. _Anal Biochem_ 162: 156–159 CAS  Google Scholar  * Holland PM, Abramson RD, Watson R,

Gelfand DH 1991 Detection of specific polymerase chain reaction product by utilizing the 5′-3′ exonuclease activity of _Thermus aquaticus_ DNA polymerase. _Proc Natl Acad Sci USA_ 88:

7276–7280 Article  CAS  Google Scholar  * Langerak AW, Szczepanski T, van der Burg M, Wolvers-Tettero ILM, van Dongen JJM 1997 Heteroduplex PCR analysis of rearranged T cell receptor genes

for the diagnosis of suspected T cell proliferations. _Leukemia_ 11: 2192–2199 Article  CAS  Google Scholar  * van Dongen JJM, Wolvers-Tettero ILM 1991 Analysis of immunoglobulin and T cell

receptor genes: I. _Clin Chim Acta_ 198: 1–91 Article  CAS  Google Scholar  * Nagata S, Suda T 1995 Fas and Fas ligand:_lpr_ and _gld_ mutations. _Immunol Today_ 16: 39–43 Article  CAS 

Google Scholar  * Stanger BZ, Leder P, Lee TH, Kim E, Seed B 1995 RIP: a novel protein containing a death domain that interacts with Fas/APO-1 (CD95) in yeast and causes cell death. _Cell_

81: 513–523 Article  CAS  Google Scholar  * Grimm S, Stanger BZ, Leder P 1996 RIP and FADD: two “death domain”-containing proteins can induce apoptosis by convergent, but dissociable,

pathways. _Proc Natl Acad Sci USA_ 93: 10923–10927 Article  CAS  Google Scholar  * Muzio M, Chinnaiyan AM, Kischkel FC, O'Rourke K, Shevchenko A, Ni J, Scaffidi C, Bertz JD, Zhang M,

Gentz R, Mann M, Krammer PH, Peter ME, Dixit VM 1996 FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/Apo-1) death-inducing signaling complex. _Cell_ 85:

817–827 Article  CAS  Google Scholar  * Muzio M, Salvesen GS, Dixit VM 1997 FLICE induced apoptosis in a cell-free system: cleavage of caspase zymogens. _J Biol Chem_ 272: 2952–2956 Article

  CAS  Google Scholar  * Dianzani U, Bragardo M, DiFranco D, Alliaudi C, Scagni P, Buonfiglio D, Redoglia V, Bonissoni S, Correra A, Dianzani I, Ramenghi U 1997 Deficiency of the Fas

apoptosis pathway without Fas gene mutations in pediatric patients with autoimmunity/lymphoproliferation. _Blood_ 89: 2871–2879 Article  CAS  Google Scholar  Download references

ACKNOWLEDGEMENTS The authors thank Professor Dr. R. Benner for providing continuous support, Professor Dr. B. A. Oostra for critical reading of the manuscript, and T.M. van Os for

preparation of the figures. We also thank Sandra de Bruin-Versteeg for technical assistance. AUTHOR INFORMATION AUTHORS AND AFFILIATIONS * Departments of Immunology, Department of

Pediatrics, Sophia Children's Hospital/University Hospital Rotterdam, The Netherlands Mirjam van der Burg, Herbert Hooijkaas, Anton W Langerak & Jacques J M van Dongen * Departments

of Pathology, and Department of Pediatrics, Sophia Children's Hospital/University Hospital Rotterdam, The Netherlands Jan C den Hollander * Erasmus University Rotterdam; Department of

Pediatrics, Dermatology, Sophia Children's Hospital/University Hospital Rotterdam, Arnold P Oranje * Department of Pediatrics, Sophia Children's Hospital/University Hospital

Rotterdam, The Netherlands Arnold P Oranje * University Hospital Rotterdam; Divisions of Pediatric Infectious Diseases and Immunology, Department of Pediatrics, Sophia Children's

Hospital/University Hospital Rotterdam, Ronald de Groot, W Marieke Comans-Bitter & Herman J Neijens * Divisions of Pediatric Infectious Diseases and Immunology, Department of Pediatrics,

Sophia Children's Hospital/University Hospital Rotterdam, The Netherlands Ronald de Groot, W Marieke Comans-Bitter & Herman J Neijens * Department of Pediatrics, Pediatric

Cardiology, Sophia Children's Hospital/University Hospital Rotterdam, The Netherlands Rolf M F Berger Authors * Mirjam van der Burg View author publications You can also search for this

author inPubMed Google Scholar * Ronald de Groot View author publications You can also search for this author inPubMed Google Scholar * W Marieke Comans-Bitter View author publications You

can also search for this author inPubMed Google Scholar * Jan C den Hollander View author publications You can also search for this author inPubMed Google Scholar * Herbert Hooijkaas View

author publications You can also search for this author inPubMed Google Scholar * Herman J Neijens View author publications You can also search for this author inPubMed Google Scholar * Rolf

M F Berger View author publications You can also search for this author inPubMed Google Scholar * Arnold P Oranje View author publications You can also search for this author inPubMed 

Google Scholar * Anton W Langerak View author publications You can also search for this author inPubMed Google Scholar * Jacques J M van Dongen View author publications You can also search

for this author inPubMed Google Scholar RIGHTS AND PERMISSIONS Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE van der Burg, M., de Groot, R., Comans-Bitter, W. _et al._

Autoimmune Lymphoproliferative Syndrome (ALPS) in a Child from Consanguineous Parents: A Dominant or Recessive Disease?. _Pediatr Res_ 47, 336–343 (2000).

https://doi.org/10.1203/00006450-200003000-00009 Download citation * Received: 21 June 1999 * Accepted: 29 October 1999 * Issue Date: 01 March 2000 * DOI:

https://doi.org/10.1203/00006450-200003000-00009 SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is

not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative