ABSTRACT Emerging evidence has demonstrated that long noncoding RNAs (lncRNAs) are promising targets or agents for the treatment of human cancers. Most liver-specific lncRNAs exhibit loss of

expression and act as tumor suppressors in liver cancer. Modulating the expression of these liver-specific lncRNAs is a potential approach for lncRNA-based gene therapy for hepatocellular

carcinoma (HCC). Here, we report that the expression of the liver-specific lncRNA FAM99B is significantly decreased in HCC tissues and that FAM99B suppresses HCC cell proliferation and

metastasis both in vitro and in vivo. FAM99B promotes the nuclear export of DDX21 through XPO1, leading to further cleavage of DDX21 by caspase3/6 in the cytoplasm. FAM99B inhibits ribosome

xenografts, providing a new strategy for the treatment of HCC. This is the first report of the use of a lncRNA as an agent rather than a target in tumor treatment. SIMILAR CONTENT BEING

VIEWED BY OTHERS KNOCKDOWN OF THE LONG NONCODING RNA PURPL INDUCES APOPTOSIS AND SENSITIZES LIVER CANCER CELLS TO DOXORUBICIN Article Open access 14 November 2022 LNCRNA SNHG6 PROMOTES

G1/S-PHASE TRANSITION IN HEPATOCELLULAR CARCINOMA BY IMPAIRING MIR-204-5P-MEDIATED INHIBITION OF E2F1 Article 06 April 2021 LINC01348 SUPPRESSES HEPATOCELLULAR CARCINOMA METASTASIS THROUGH

INHIBITION OF SF3B3-MEDIATED EZH2 PRE-MRNA SPLICING Article 17 June 2021 INTRODUCTION Long noncoding RNA (lncRNA) play crucial regulatory roles in tumors and are increasingly being applied

in cancer therapy. LncRNAs regulate tumor cell proliferation, invasion, metastasis, and chemoresistance by influencing chromosome silencing, genomic imprinting, chromatin remodeling,

transcriptional regulation, and nuclear transport [1], thereby impacting tumor initiation and progression [2]. Emerging evidence indicates that lncRNAs are promising targets or therapeutic

agents for cancer treatment. A variety of RNA-based therapeutic agents and strategies have been developed, including antisense oligonucleotides (ASOs), small interfering RNAs (siRNAs), short

hairpin RNAs (shRNAs), miRNA mimics, therapeutic circular RNAs (circRNAs), and CRISPR/Cas9-based gene editing [3,4,5]. Liver cancer is a significant global health threat. Primary liver

cancer is the sixth most common cancer worldwide and is the second-leading cause of cancer-related death in men and the sixth-leading cause of cancer death in women [6]. The 5-year survival

rate of patients with hepatocellular carcinoma (HCC) is still only ~20% [7]. The poor prognosis of HCC is attributed to its early asymptomatic nature, which lead to late diagnosis, and its

significant resistance to traditional chemotherapy and radiotherapy [8]. Studying the mechanisms of HCC occurrence and development, identifying new tumor markers, and developing novel

therapeutic approaches to extend the survival period of patients are urgent priorities. Tissue-specific lncRNAs often perform specific functions in tissues. Notably, most liver-specific

lncRNAs exhibit loss of expression in liver cancer, and usually suppress tumor development and progression [9,10,11,12]. Therefore, regulating the expression of these liver-specific lncRNAs

is a potential strategy for lncRNA-based gene therapy for HCC. Studies have reported that FAM99B in exosomes derived from human umbilical cord mesenchymal stem cells (hucMSC-Exo) induces

cell cycle arrest and apoptosis, suppressing HCC development and progression [13]. Additionally, researchers have predicted that FAM99B is involved in “metabolic pathways” and “blood

coagulation” pathways [11]. Other studies have indicated that FAM99B is associated with the response to wounding, lipid biosynthesis, and the regulation of lipid metabolism [12]. However,

the molecular mechanisms of FAM99B in tumors remain unexplored and lack experimental validation. In our study, FAM99B exerts its function through interaction with DDX21. DDX21 (Dead-Box

Helicase 21), a member of the DEAD-box family, is an RNA helicase that uses the energy generated by ATP hydrolysis to catalyze the unwinding of double-stranded RNA or RNA‒DNA hybrids [14].

DDX21 is recognized as an important nucleolar protein involved in ribosomal RNA (rRNA) processing and plays a multifaceted role in multiple steps of ribosome biogenesis [15]. Previous

studies have shown that depletion of DDX21 results in significant reductions in the 18S and 28S rRNA levels in numerous cell types [16, 17]. DDX21 contributes to the development of multiple

human cancers, including breast cancer [18], gastric cancer [19], melanoma [20], colorectal cancer [21], and neuroblastoma [22], but its role in HCC has not been reported. In this study, we

report a liver-specific lncRNA, FAM99B, which is strongly downregulated in HCC and serves as an independent predictor of overall survival in HCC patients. FAM99B interacts with DDX21 and

decreases the DDX21 protein level via caspase3/6-mediated cleavage in HCC cells. FAM99B inhibits ribosome biogenesis and protein synthesis by downregulating DDX21, thus suppressing the

proliferation and metastasis of HCC cells. Notably, the FAM99B65-146 truncation can significantly inhibit the progression of HCC, and N-acetylgalactosamine (GalNAc)-conjugated FAM99B65-146

(GalNAc-FAM99B65-146) attenuates the growth and metastasis of orthotopic tumor xenografts in vivo, providing a new strategy and approach for the treatment of HCC. RESULTS THE LIVER-SPECIFIC

LNCRNA FAM99B ACTS AS A TUMOR SUPPRESSOR IN HCC First, we systematically analyzed tissue-associated RNA-seq data in the Genotype-Tissue Expression (GTEx) database and identified numerous

tissue-specific lncRNAs expressed in different human tissues (Supplemental Table S1, Fig. 1A). Furthermore, we screened for liver-specific lncRNAs by using the Liver Hepatocellular Carcinoma

(LIHC) dataset from The Cancer Genome Atlas (TCGA; https://portal.gdc.cancer.gov/) and identified 13 candidates that exhibited downregulated expression (fold change <0.67) in liver

cancer patients and were associated with a better prognosis in HCC (_p_ ≤ 0.05) (Supplemental Table S1, Fig. 1B). Notably, FAM99B was expressed almost exclusively in the liver (Fig. 1C).

Moreover, we analyzed data from 370 HCC patients in the TCGA-LIHC cohort and 105 HCC patients in the GepLiver project cohort (http://www.gepliver.org/). The results revealed that FAM99B was

downregulated in HCC (Fig. 1D), and a similar result was found in two different HCC datasets in the Gene Expression Omnibus (GEO) database (GSE77314 and GSE144269) (Supplemental Fig. S1A).

Further analysis revealed that high expression of FAM99B was associated with a better prognosis in HCC (Fig. 1E and Supplemental Fig. S1B). The full-length sequence of FAM99B contains 1066

nucleotides, as identified by 3’ rapid amplification of cDNA ends (RACE) and 5’ RACE (Supplemental Fig. S1C and S1D). Analysis of subcellular localization through nuclear‒cytoplasmic

fractionation and immunofluorescence staining revealed that FAM99B was localized predominantly in the nucleus in hepatocytes (Fig. 1F and Supplemental Fig. S1E). Cell Counting Kit-8 (CCK-8)

and colony formation assays revealed that the overexpression of FAM99B significantly inhibited the proliferation of HCC cells (Supplemental Fig. S2A–D). Migration and invasion assays

revealed that FAM99B significantly inhibited the migration and invasion of HCC cells (Supplemental Fig. S2E). To further validate the biological function of FAM99B in vivo, overexpressed

FAM99B and control Huh7 cells were subcutaneously injected into the flanks of nude mice, and body weight changes and tumor formation were monitored regularly. The results revealed that

FAM99B-overexpressing tumors grew much slower (Fig. 1G and Supplemental Fig. S2F) and weighed less (Fig. 1H) than control tumors. In addition, Ki-67 staining revealed that the cell

proliferation rate in tumors formed from FAM99B-overexpressing cells was lower than that in tumors formed from control cells (Supplemental Fig. S2G and S2H). Next, we established an

orthotopic xenograft mouse model via intrahepatic injection of Huh7 cells with stable overexpression of FAM99B to evaluate the effects of FAM99B on HCC metastasis. In this model,

overexpression of FAM99B dramatically inhibited HCC cell metastasis (Supplemental Fig. S2I and S2J, Fig. 1I and J). These results indicate that FAM99B is a bona fide tumor suppressor in HCC.

FAM99B EXERTS ITS BIOLOGICAL FUNCTIONS THROUGH AN INTERACTION WITH DDX21 To explore the molecular mechanisms by which FAM99B suppresses the proliferation and metastasis of HCC cells, we

performed an RNA pulldown assay coupled with mass spectrometry (MS) to screen for potential binding partners of FAM99B. In our analysis of the results of MS analysis of the RNA pulldown

products, we screened for proteins with a coverage (the percentage of the protein sequence covered by identified peptides) of ≥5 and a fold change between sense/antisense transcripts of ≥5.

Considering that FAM99B is located in the nucleus, we identified 9 candidates that might interact with FAM99B. Among these candidates, DDX21 was the protein with the most significant binding

to FAM99B (Supplemental Fig. S3A, Fig. 2A and B). Immunofluorescence staining revealed colocalization of FAM99B and DDX21 in the nucleus in HCC cells (Fig. 2C). To clarify which domain of

DDX21 binds to FAM99B, we next constructed Flag-tagged full-length DDX21 and truncation mutants of DDX21 on the basis of its functional domains (fragment #1: 210–783 aa, fragment #2: 425–783

aa, fragment #3: 1–385 aa, and fragment 4: 1–620 aa) (Fig. 2D). In the subsequent RNA immunoprecipitation (RIP) assays, we found that deletion of the C-terminal domain dramatically impaired

the FAM99B–DDX21 interaction (Fig. 2E). These results indicate that FAM99B binds to the C-terminal domain of DDX21. Previous reports have shown that DDX21 acts as a tumor promoter in

several cancers [19,20,21,22]. However, the function of DDX21 in HCC is still unclear. Our results demonstrated that overexpression of DDX21 promoted the growth, colony formation, migration

and invasion of HCC cells (Supplemental Fig. S3B–D and S3G). However, knockdown of DDX21 inhibited these behaviors of HCC cells (Supplemental Fig. S3E, S3F and S3H). To determine whether

DDX21 is a functional effector of FAM99B, we overexpressed FAM99B and DDX21 in Huh7 and HepG2 cells. The results revealed that overexpression of DDX21 abolished the inhibitory effects of

FAM99B on HCC cells (Supplemental Fig. S3I and Fig. 2F, G, Fig. 2H). These results suggest that FAM99B reduces the proliferation and metastasis of HCC cells by downregulating DDX21. FAM99B

PROMOTES THE NUCLEAR EXPORT OF DDX21 AND ITS CLEAVAGE BY CASP3/6 Next, we sought to determine the consequences of the interaction between FAM99B and DDX21 in HCC cells. Neither

overexpression nor knockdown of FAM99B affected the mRNA level of DDX21 (Supplemental Fig. S4A). Modulation of DDX21 expression did not affect the expression of FAM99B (Supplemental Fig.

S4B). However, overexpression of FAM99B led to a decrease in the protein level of DDX21, whereas knockdown of FAM99B resulted in an increase in the protein level of DDX21 (Fig. 3A). These

results indicate that FAM99B can downregulate the protein levels of DDX21. To explore the cause of these effects on the DDX21 protein level, we treated Huh7 cells with stable FAM99B

overexpression with MG132 (proteasome inhibitor), leupeptin (lysosomal inhibitor), MG101 (calpain inhibitor), and Z-VAD-FMK (pancaspase inhibitor). Treatment with Z-VAD-FMK suppressed the

FAM99B-induced downregulation of DDX21 at the translational level (Fig. 3B, C). The caspase family contains numerous members. We interfered with all the caspase family members expressed in

Huh7 and HepG2 cells (Supplemental Fig. S4C) and found that interfering with the expression of caspase3 and caspase6 in Huh7 cells reversed the downregulation of DDX21 caused by FAM99B

overexpression. Similarly, in HepG2 cells, interfering with the expression of caspase3, caspase6, and caspase7 restored the downregulation of DDX21 (Supplemental Fig. S4D). The same effects

were observed after interference with the expression of caspase3 and caspase6 in Huh7 and HepG2 cells with stable overexpression of FAM99B (Supplemental Fig. S4E and S4F, Fig. 3D). In

addition, DDX21 bound to caspase3 and caspase6 in Huh7 cells (Supplemental Fig. S4G). These results indicate that FAM99B might regulate the DDX21 protein level via casp3/6 in HCC cells.

Since the caspase family is usually localized in the cytoplasm, we hypothesized that FAM99B might regulate the nucleocytoplasmic distribution of DDX21. Using nuclear-cytoplasmic

fractionation experiments and immunofluorescence analysis, we found that overexpression of FAM99B led to the translocation of DDX21 from the nucleus to the cytoplasm (Fig. 3E and J). We next

sought to investigate the mechanism by which DDX21 is exported to the cytoplasm. The majority of macromolecular (>40 kDa) transport across nuclear pores is mediated by the Karyopherin-β

family of nuclear transport receptors [23]. To identify the specific nuclear export protein involved, we individually knocked down XPO1, XPO2, XPO3, XPO5, and XPO6 in FAM99B-overexpressing

Huh7 cells, followed by nuclear-cytoplasmic fractionation (Supplemental Fig. S4H). The results revealed that knockdown of XPO1 effectively inhibited FAM99B-induced nuclear export of DDX21,

whereas silencing other exportins did not affect DDX21 localization (Supplemental Fig. S4I). This suggests that XPO1 may be the exportin mediating the nuclear export of DDX21 in

FAM99B-overexpressing cells. To further validate this finding, we performed XPO1 knockdown experiments in FAM99B-overexpressing HepG2 cells, followed by nuclear-cytoplasmic fractionation and

immunofluorescence analysis. XPO1 depletion significantly reduced the cytoplasmic distribution of DDX21, almost abolishing it, while concurrently increasing its nuclear localization (Fig.

3F and H, Supplemental Fig. S4H). Moreover, co-immunoprecipitation assays demonstrated that FAM99B overexpression enhanced the interaction between DDX21 and XPO1. Collectively, these results

indicate that in HCC cells, FAM99B overexpression recruits the export protein XPO1 to facilitate the translocation of DDX21 from the nucleus to the cytoplasm. DDX21 was reported to be

cleaved at D126 by casp3/6 in response to vesicular stomatitis virus infection in HeLa cells [24]. Thus, we transfected plasmids containing Flag-tagged DDX21WT and the DDX21D126A mutant into

Huh7 cells and found that the DDX21WT protein level was significantly reduced but the DDX21D126A protein level was not decreased (Supplemental Fig. S4J). These results indicate that FAM99B

promotes the export and degradation of DDX21 via casp3/6-mediated cleavage at D126. FAM99B INHIBITS MRNA TRANSLATION THROUGH SUPPRESSION OF DDX21 EXPRESSION IN HCC CELLS To explore the

molecular pathway of FAM99B and DDX21 in HCC cells, we performed RNA-seq after overexpression of FAM99B or knockdown of DDX21. The gene set enrichment analysis (GSEA) results revealed that

genes related to the Ribosome pathway were significantly downregulated in FAM99B-overexpressing and DDX21-silenced HCC cells (Fig. 4A, B). Since the ribosome is a component of the

translation machinery, we hypothesized that FAM99B and DDX21 might regulate mRNA translation in HCC cells. To test this hypothesis, we performed surface sensing of translation (SUnSET), a

method for monitoring overall protein synthesis by detecting puromycin-labeled polypeptides. The results revealed that global protein synthesis was increased after FAM99B knockout and that

overexpression of FAM99B decreased global protein synthesis in HCC cells (Fig. 4C), but this decrease was reversed by overexpression of DDX21 (Fig. 4D). In addition, we performed an

O-propargyl-puromycin (OP-Puro) assay to measure the incorporation of OP-Puro-tagged polypeptides. Fluorescence intensity in cells was analyzed using laser confocal microscopy or

Fluorescence-Activated Cell Sorting (FACS). The results demonstrated that the overall translation activity in HepG2 cells with FAM99B knockout was significantly higher compared to the

control cells. In contrast, overexpression of FAM99B resulted in a marked decrease in protein synthesis in Huh7 cells (Fig. 4E and Supplemental Fig. S5A), although restoration of DDX21

expression rescued this phenotype in Huh7 and HepG2 cells (Fig. 4F). Consistent with these findings, knockdown of DDX21 in Huh7 and HepG2 cells significantly reduced overall translation

activity (Supplemental Fig. S5B–D). These results indicated that FAM99B suppressed protein translation in HCC cells by downregulating the expression of DDX21. FAM99B INHIBITS RIBOSOME

BIOGENESIS BY REGULATING RRNA PROCESSING AND RPS29/RPL38 TRANSCRIPTION VIA DDX21 IN HCC CELLS Next, we aimed to explore the mechanism by which FAM99B and DDX21 affect global protein

synthesis in HCC cells. DDX21, which is localized in the nucleolus, can promote rRNA transcription, processing and modification [15]. To determine whether rRNA transcription and processing

are affected by FAM99B and DDX21 in HCC cells, we examined the abundances of various pre-rRNAs and mature rRNAs by quantitative northern blotting in Huh7 cells. Compared with control cells,

FAM99B-overexpressing cells exhibited accumulation of 47/45S pre-rRNA and 30S pre-rRNA but decreased signals of 21S and 18S-E pre-rRNA (Fig. 5A). These results indicated an additional defect

in the initial cleavage of pre-rRNAs at the A site after overexpression of FAM99B (Fig. 5A and Supplemental Fig. S6A), whereas restoration of DDX21 expression rescued this phenotype (Fig.

5B). Similarly, the knockdown of DDX21 in Huh7 cells resulted in the accumulation of 47/45S pre-rRNA and 30S pre-rRNA but reductions in the 21S and 18S-E pre-rRNA signals (Supplemental Fig.

S6B). These results indicate that FAM99B and DDX21 can regulate the processing of pre-rRNAs at the A site. Additionally, GSEA of the RNA-seq data from cells with FAM99B overexpression and

DDX21 knockdown revealed that FAM99B and DDX21 regulate the expression of RPs at the transcriptional level. To determine whether FAM99B/DDX21 can regulate the levels of RPs, chromatin

immunoprecipitation followed by sequencing (ChIP-seq) was performed, and the results revealed that DDX21 was abundant at the promoters of RPS29 and RPL38 (Fig. 5C–E). After DDX21 knockdown,

DDX21 enrichment at the RPS29/RPL38 promoters was reduced, suggesting that DDX21 may regulate RPS29/RPL38 transcription (Supplemental Fig. S6C and Fig. 5E). Knockdown of DDX21 resulted in

significant downregulation of the mRNA and protein expression of RPS29/RPL38 (Fig. 5F, G). These results indicate that DDX21 regulates the transcription of RPS29/RPL38. Because FAM99B and

DDX21 affect pre-rRNA processing and the expression of the RPs RPS29 and RPL38, we speculated that FAM99B and DDX21 can further influence ribosome biogenesis. By using puromycin to

dissociate 80S and polysomal ribosomes into free 40S and 60S subunits [25], we performed polysome profiling and revealed that the 40S and 60S subunits in FAM99B-overexpressing cells and

DDX21-silenced cells were decreased compared with those in the corresponding control cells (Fig. 5H and Supplemental Fig. S6C). DDX21 overexpression reversed the reductions in the 40S and

60S fractions caused by FAM99B overexpression (Fig. 5I). These results indicate that FAM99B affects ribosome biogenesis by regulating rRNA processing and RPS29/RPL38 transcription via DDX21

in HCC cells. THE FAM99B65-146 FRAGMENT PLAYS A SUPPRESSIVE ROLE IN HCC CELLS To explore the potential therapeutic role of FAM99B in HCC, we first aimed to identify the fragment of FAM99B

that plays an inhibitory role in HCC cells. To identify the region of FAM99B that interacts with DDX21, we constructed 3 truncated fragments of FAM99B (fragment A: 1-239; 869-1066 nt,

fragment B: 240-573 nt, fragment C: 574-868 nt) on the basis of the secondary structure predicted by RNAfold (http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi) (Fig. 6A,

Supplemental Fig. S7A, B). RNA pulldown experiments with the truncated FAM99B fragments A, B and C indicated that fragment A of FAM99B binds to DDX21 (Fig. 6B). Then, on the basis of the

secondary structure of FAM99B, fragment A was further truncated to generate truncations A1, A2, A3 and A4 (fragment A1: 177-239; 869-926 nt, fragment A2: 927-1008 nt, fragment A3: 1-41;

1009-1066 nt, fragment A4: 42-176 nt). The results of RNA pulldown experiments with FAM99B truncations A1, A2, A3 and A4 indicated that the truncation A4 of FAM99B binds to DDX21 (Fig. 6C).

Similarly, on the basis of the secondary structure, truncation A4 of FAM99B was further truncated to generate FAM99B truncations A4-1, A4-2, A4-3 and A4-4 (fragment #A4-1: 42-64 nt, fragment

#A4-2: 65-146 nt, fragment #A4-3:147-176 nt). The results of RNA pulldown experiments indicated that truncation A4-2 of FAM99B binds to DDX21 (Fig. 6D). Thus, the fragment of FAM99B that

interacts with DDX21 is represented by truncation A4-2 (hereafter referred to as FAM99B65-146). To confirm whether FAM99B65-146 inhibits the progression of HCC, we overexpressed FAM99B65-146

in Huh7 and HepG2 cells, and the results revealed that FAM99B65-146 inhibited the proliferation, colony formation, migration and invasion of Huh7 and HepG2 cells (Fig. 6E–G and Supplemental

Fig. S7C, D). As expected, FAM99B65-146 was able to downregulate the protein levels of DDX21, thereby inhibiting ribosome biogenesis and protein synthesis in HCC cells (Fig. 6H–J,

Supplemental Fig. S7E–G), whereas FAM99B△65–146 showed no such effects (Fig. 6I, Supplemental Fig. S7F, G). Thus FAM99B65-146 exhibiting activity similar to that of full-length FAM99B. These

results indicate that FAM99B65-146 is the region of FAM99B that binds to DDX21 and that FAM99B65-146 can decrease the protein level of DDX21, inhibit protein synthesis, and play a

suppressive role in HCC cells. GALNAC-FAM99B65-146 ADMINISTRATION EFFECTIVELY ATTENUATES THE GROWTH AND METASTASIS OF ORTHOTOPIC XENOGRAFT TUMORS GalNAc is a natural ligand of the

asialoglycoprotein receptor (ASGPR), which is highly expressed on the membrane surface of hepatocytes and mediates clathrin-mediated endocytosis. Because GalNAc is an advanced platform for

liver-targeted delivery, it is used in various RNA therapeutics, and several conjugates are in phase I-III clinical trials [16, 26, 27]. FAM99B is liver specific, and FAM99B65-146 inhibits

the proliferation and metastasis of HCC cells in vitro. Therefore, the administration of GalNAc-FAM99B65-146 might constitute a novel strategy for the treatment of HCC. To test this

hypothesis, we first conducted RT‒qPCR to examine the of GalNAc conjugation on the overexpression efficiency of FAM99B65-146 and found an overexpression efficiency of 25-fold (Supplemental

Fig. S8A). Moreover, GalNAc-FAM99B65-146 inhibited the proliferation, colony formation, migration and invasion of Huh7 cells (Fig. 7A and Supplemental Fig. S8B). To investigate the

therapeutic effects of GalNAc-FAM99B65-146 on HCC, we orthotopically injected Huh7 cells stably expressing Luciferase into the livers of BALB/c nude mice to establish an orthotopic xenograft

model of HCC. The mice were subcutaneously administered two 5 mg/kg doses of GalNAc-FAM99B65-146 or GalNAc-NC (_n_ = 6 mice/group) (Fig. 7B). We analyzed weekly imaging data from nude mice

bearing orthotopic liver xenografts and found that the tumor area in the GalNAc-FAM99B65-146 treatment group was significantly smaller than that in the control group on day 21, indicating a

lower tumor growth rate (Fig. 7C, D and Supplemental Fig. S8C). Consistent with this observation, staining for the cell proliferation marker Ki67 revealed that the expression of Ki67 was

decreased in the GalNAc-FAM99B65-146 treatment group (Fig. 7E). Moreover, H&E staining revealed fewer intrahepatic metastases in the GalNAc-FAM99B65-146 treatment group (Fig. 7F, G). As

expected, the protein level of DDX21 in the xenografts was significantly reduced after treatment with GalNAc-FAM99B65-146 (Fig. 7E and H). These results indicate that GalNAc-FAM99B65-146

treatment significantly inhibited the growth and metastasis of orthotopic tumor xenografts. Futhermore, we monitored the body weight of the mice from day 7 to day 21. The results showed that

no significant weight loss in the treatment mice (Supplemental Fig. S8D). In addition, we analyzed the expression levels of FAM99B65-146 in the liver and lung tissues. The results revealed

that FAM99B65-146 did not accumulate in the lung tissue, but was retained in the liver tissue (Supplemental Fig. S8E, F). These results can initially indicate that GalNAc-FAM99B65-146 does

not cause observable toxicity in mice. In conclusion, these results indicate that GalNAc-FAM99B65-146 administration is a potential therapeutic strategy for HCC. DISCUSSION In this study, we

identified lncRNAs specifically expressed in the liver and found that FAM99B is frequently downregulated and functions as a tumor suppressor in HCC. It has been reported that FAM99B

inhibits HCC cell proliferation, migration, and invasion in vitro [11]. Another study revealed that FAM99B in exosomes derived from human umbilical cord mesenchymal stem cells (hucMSC-Exo)

induced cell cycle arrest and apoptosis, inhibited HCC cell migration and invasion, and suppressed HCC tumorigenesis in vivo [28]. Our study revealed that FAM99B inhibited ribosome

biogenesis and protein translation by regulating rRNA processing and RP transcription, thereby decreasing the proliferation, tumorigenicity, and metastasis of HCC cells in vitro and in vivo.

Thus, our findings reveal a novel biological role of FAM99B in HCC. FAM99B was predicted to be involved mainly in the “Metabolic pathways” and “Blood coagulation” pathways by analysis of

coexpressed genes [11] and in the pathways related to the terms response to wounding and lipid biosynthetic process through enrichment analysis of FAM99B-binding proteins [12]. However, the

molecular mechanisms of FAM99B in tumors have not been experimentally validated or further explored. In this study, we found that FAM99B can bind to DDX21 and decrease its protein expression

level. FAM99B promotes the export of DDX21 from the nucleus by recruiting XPO1. Relatively large cargo molecules (>40 kDa) require active transport via transport receptors [29, 30];

these receptor proteins are classified as importins (for nuclear import), exportins (for nuclear export), and transportins (for both import and export) [31]. CRM1/Xpo1 is the most important

and best characterized exportin [31, 32]. However, when XPO1 was knocked down, overexpression of FAM99B did not increase the translocation of DDX21 to the cytoplasm; instead, it remained in

the nucleus. After export from the nucleus, DDX21 is cleaved at D126 via casp3/6 in the cytoplasm, leading to its degradation. It has been reported that DDX21 undergoes caspase-dependent

cleavage after RNA virus infection or treatment with RNA/DNA ligands [24, 33], but the mechanism by which DDX21 is translocated to the cytoplasm has not been further explored. Here, we

revealed that the protein level of DDX21 is decreased by the lncRNA FAM99B via casp3/6, suggesting the mechanism underlying the nuclear export of DDX21. DDX21 is required for RNA helicase

activity and controls multiple steps of ribosome biogenesis in human cells [17, 18, 34]. DDX21 is a component of the human UTP-B complex and is found in early and late preribosomal

intermediates [35]. DDX21 interacts with SIRT7, which deacetylates DDX21 to increase its R-loop-unwinding activity and overcomes R-loop-mediated stalling of RNA polymerases [14]. Recently,

it has been reported that DDX21 binds to the methyltransferase complex (MTC), facilitating the recruitment of the MTC to R-loops. The MTC, in turn, recruits the nuclease XRN2 to promote

transcription termination. Failure to recruit the MTC via DDX21 leads to transcriptional readthrough, which results in DNA damage [36]. In the nucleolus, DDX21 occupies the transcribed rDNA

locus, directly contacts both rRNAs and snoRNAs, and promotes rRNA transcription, processing and modification. In the nucleoplasm, DDX21 binds 7SK RNA and is recruited to the promoters of

Pol II-transcribed genes encoding RPs and snoRNAs, thereby promoting the transcription of its target genes [15]. In addition, DDX21 forms ring-shaped structures surrounding multiple Pol I

complexes and suppresses pre-rRNA transcription; moreover, the binding of the lncRNA SLERT allosterically alters individual DDX21 molecules, loosens the DDX21 ring, and evicts DDX21,

relieving its suppression of Pol I transcription [37]. However, the biological function and mechanism of DDX21 in HCC have not been reported. Here, we found that DDX21 was regulated by the

lncRNA FAM99B, which decreased the DDX21 protein level. DDX21 inhibited rRNA processing and RPS29/RPL38 transcription, resulting in decreased assembly of the 40 S and 60 S ribosomal subunits

and the inhibition of ribosome biogenesis, thereby further reducing overall protein synthesis in HCC cells. The natural receptor for GalNAc is highly expressed in hepatocytes. GalNAc is a

clinically advanced platform, convenient to administer, and stably metabolized; thus, it has broad applicability in RNAi delivery for cancer therapy [38, 39]. The GalNAc–siRNA conjugates

givosiran, which is used to treat acute intermittent hepatic porphyria [40], and lumasiran [41], which is used to treat primary hyperoxaluria type 1, have been approved by the FDA.

Inclisiran is used to treat hypercholesterolemia or mixed dyslipidemia by inhibiting the hepatic synthesis of proprotein convertase subtilisin–kexin type 9 (PCSK9) [42, 43]. In the present

study, the vast majority of studies using lncRNA for cancer regard it as a target for cancer therapy. GalNAc-conjugated siRNA-mediated inhibition of lncRNA expression was used to treat

cancer. For example, there was a study showed that GalNAc-conjugated siRNAs targeting lncRNA16 can restore chemosensitivity and inhibit tumor growth, and combining first-line platinum-based

chemotherapy with lncRNA16 interference can significantly increase the antitumor efficacy [44]. GalNAc–siURB1-AS1 specifically inhibited the expression of the lncRNA URB1-AS1 in an in vivo

tumor model and significantly sensitized sorafenib-resistant HCC cells to sorafenib and inhibited tumor growth [45]. It is worth noting that a study on the treatment of phenylketonuria (PKU)

used lncRNA as a therapeutic agent, which reported that GalNAc-labeled lncRNA HULC mimics treatment reduced the excess phenylalanine (Phe) concentration in mice, providing a potential

intervention measure for PKU patients [46]. In our study, GalNAc-FAM99B65-146 inhibited the growth and metastasis of orthotopic HCC xenografts. These results indicate that

GalNAc-FAM99B65-146 has potential therapeutic utility in HCC. Our study provides a new approach for the application of lncRNAs in gene therapy and reveals a potential strategy for the

treatment of HCC. This is the first report of the use of a lncRNA as an agent rather than a target in tumor treatment. In conclusion, FAM99B is a liver-specific lncRNA and is downregulated

in HCC. FAM99B binds to DDX21 and promotes the nuclear export of DDX21 by interacting with XPO1. DDX21 is degraded via caspase3/6-mediated cleavage at D126 in the cytoplasm. FAM99B inhibits

rRNA processing and RPS29/RPL38 transcription via DDX21, leading to reduced ribosome biogenesis and decreased protein synthesis, resulting in inhibition of the proliferation and metastasis

of HCC cells in vivo and in vitro. Notably, the administration of GalNAc-FAM99B65-146 effectively inhibited the growth and metastasis of orthotopic xenograft tumors in vivo, revealing a

promising strategy for the treatment of HCC (Fig. 8). METHODS IN VIVO ASSAYS Female athymic BALB/c nude mice, aged 6 weeks, were injected subcutaneously with 0.2 ml of a suspension

containing 1 × 106 Huh7 cells (pWPXL-VECTOR or pWPXL-FAM99B) in the right axilla. The tumor growth rate was monitored, and the tumor volume was calculated according to the following formula:

volume = length × width2 × 0.5. To further investigate the effect of FAM99B on tumor invasion in vivo, we established a metastasis model in nude mice by injecting 1 × 106 Huh7 cells

(pWPXL-VECTOR or pWPXL-FAM99B) into the liver. Seven weeks later, the mice were sacrificed, and the livers were harvested. RNA-SEQ AND GSEA RNA from cells with stable FAM99B overexpression

and DDX21 knockdown was extracted with TRIzol reagent (Invitrogen, CA, USA), the RiboMinus Eukaryote Kit (QIAGEN, CA, USA) was used to remove rRNA, and the NEBNext Ultra Directional RNA

Library Prep Kit (New England Biolabs, MA, USA) was used to construct the RNA-seq library. The read count of each gene was normalized Fragments Per Kilobase of transcript per Million mapped

reads (FPKM) method. The fold change in the expression level in the control group compared with the overexpression/knockdown group was calculated for each target gene, and genes with a fold

change in expression >1.5 after FAM99B overexpression or <0.67 after DDX21 knockdown were imported for GSEA. SUNSET METHOD HCC cells were treated with 10 μg/ml puromycin (New England

Biolabs, MA, USA; Biotech, Shanghai, China) at 37 °C in an incubator with 5% CO2 for 30 min and were then lysed in SDS loading buffer (Epizyme, Shanghai, China). Cell lysates were analyzed

via western blotting with an anti-puromycin antibody. POLYSOME PROFILING HCC cells were treated with 100 μg/ml cycloheximide (CHX; Sangon Biotech, Shanghai, China) at 37 °C with 5% CO2 for 3

 min. Lysis buffer was added to the cells for 30 min, and the cells were then incubated with RNase I (Vazyme, Nanjing, China) and DNase I (NEB, UK) for 45 min. The monomers were separated by

sucrose cushion centrifugation at 50,000 rpm for 2 h at 4 °C. The absorbance of each sample was measured at 260 nm. OP-PURO ASSAY The OPP assay was performed with a Click-iT Plus OPP Alexa

Fluor 488 protein synthesis test kit (Thermo Fisher Scientific, Carlsbad, California, USA) according to the manufacturer’s instructions. IN VIVO ASSAYS For the subcutaneous tumor formation

assay in nude mice, Huh7 cells (1 × 106) with NC or FAM99B overexpression were injected subcutaneously into 6-week-old female BALB/c nude mice. Four weeks later, the mice were sacrificed,

and the livers were harvested. For the orthotopic xenograft assay, Huh7 cells (1 × 106) with NC or FAM99B overexpression were injected into the livers of 6-week-old female BALB/c nude mice.

One month later, the mice were sacrificed, and the livers were harvested. For GalNAc-RNA treatment in the liver orthotopic xenograft model: GalNAc-RNA was synthesized by Hippobio (Huzhou,

China). The sequence of NC in GalNAc-NC is: GCCUGCCCCUCGCGCAUCCGGGUGCUACUGGAGGAGCGGGAGCGGGAAAUAGGUGCCGCAGGCCCAGCCGCACAGAAUGGCA. The sequence of FAM99B65-146 in GalNAc-FAM99B65-146 is

GGCUGUGUGGCCCCAGCUCCCUG AGCCCAGAGGGAGGUGAGGGUGAGAAGGCCUGGACCAGGCAGGACGCAGCCCCCAGGGC. The GalNAc-RNA conjugate was modified with dioxymethyl and a fluoro group to increase its stability in

vivo, and the 3’ end was modified with GalNAc. Each BALB/c nude mouse was intrahepatically injected with 4 × 107 Huh7 cells (with stable expression of EGFP-Luciferase) to establish

orthotopic xenografts. Seven days after orthotopic transplantation, the mice were randomly divided into two groups according to the bioluminescence intensity and were treated with GalNAc-NC

or GalNAc-FAM99B65-146 (5 mg/kg) via subcutaneous injection weekly for 2 weeks, after which in vivo imaging was performed. At the end of the third week, the mice were euthanized, and their

livers were harvested and photographed. The tumor tissues were retained for RNA and protein extraction, and the mouse liver and lung tissues were fixed with 4% paraformaldehyde for

subsequent H&E staining and immunohistochemical (IHC) staining. STATISTICAL ANALYSIS All the statistical analyses were performed via GraphPad Prism software (version 9.0). Student’s

_t_-test was used to determine the significance of differences between two groups; one-way ANOVA was used to determine the significance of differences based on one variable among multiple

groups; two-way ANOVA was used to determine the significance of differences based on two variables among multiple groups. A value of _p_ < 0.05 was considered to indicate statistical

significance, which was denoted as follows: *_p_ < 0.05, **_p_ < 0.01, ***_p_ < 0.001, ****_p_ < 0.0001. The abbreviation “ns” indicates statistical insignificance. DATA

AVAILABILITY Data supporting the findings of the current study are available in the NCBI Gene Expression Omnibus (accession no: GES271217). CHANGE HISTORY * _ 02 MAY 2025 The original online

version of this article was revised: In this article the supplementary file has been updated. _ * _ 06 MAY 2025 A Correction to this paper has been published:

https://doi.org/10.1038/s41419-025-07681-2 _ REFERENCES * Huang Z, Zhou JK, Peng Y, He W, Huang C. The role of long noncoding RNAs in hepatocellular carcinoma. Mol Cancer. 2020;19:77.

Article  CAS  PubMed  PubMed Central  Google Scholar  * Hong Y, Zhang Y, Zhao H, Chen H, Yu QQ, Cui H. The roles of lncRNA functions and regulatory mechanisms in the diagnosis and treatment

of hepatocellular carcinoma. Front Cell Dev Biol. 2022;10:1051306. Article  PubMed  PubMed Central  Google Scholar  * Ling H, Fabbri M, Calin GA. MicroRNAs and other non-coding RNAs as

targets for anticancer drug development. Nat Rev Drug Discov. 2013;12:847–65. Article  CAS  PubMed  PubMed Central  Google Scholar  * Rupaimoole R, Slack FJ. MicroRNA therapeutics: towards a

new era for the management of cancer and other diseases. Nat Rev Drug Discov. 2017;16:203–22. Article  CAS  PubMed  Google Scholar  * Winkle M, El-Daly SM, Fabbri M, Calin GA. Noncoding RNA

therapeutics - challenges and potential solutions. Nat Rev Drug Discov. 2021;20:629–51. Article  CAS  PubMed  PubMed Central  Google Scholar  * Sung H, Ferlay J, Siegel RL, Laversanne M,

Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71:209–49.

Article  PubMed  Google Scholar  * Siegel RL, Giaquinto AN, Jemal A. Cancer statistics, 2024. CA Cancer J Clin. 2024;74:12–49. Article  PubMed  Google Scholar  * Llovet JM, Zucman-Rossi J,

Pikarsky E, Sangro B, Schwartz M, Sherman M, et al. Hepatocellular carcinoma. Nat Rev Dis Primers. 2016;2:16018. Article  PubMed  Google Scholar  * Zheng YL, Li L, Jia YX, Zhang BZ, Li JC,

Zhu YH, et al. LINC01554-mediated glucose metabolism reprogramming suppresses tumorigenicity in hepatocellular carcinoma via downregulating PKM2 expression and inhibiting Akt/mTOR signaling

pathway. Theranostics. 2019;9:796–810. Article  CAS  PubMed  PubMed Central  Google Scholar  * He J, Zuo Q, Hu B, Jin H, Wang C, Cheng Z, et al. A novel, liver-specific long noncoding RNA

LINC01093 suppresses HCC progression by interaction with IGF2BP1 to facilitate decay of GLI1 mRNA. Cancer Lett. 2019;450:98–109. Article  CAS  PubMed  Google Scholar  * Mo M, Liu S, Ma X,

Tan C, Wei L, Sheng Y, et al. A liver-specific lncRNA, FAM99B, suppresses hepatocellular carcinoma progression through inhibition of cell proliferation, migration, and invasion. J Cancer Res

Clin Oncol. 2019;145:2027–38. Article  CAS  PubMed  Google Scholar  * Jin H, Li Y, Qin S, Li Q, Mao Y, Zhao L. The comprehensive roles of lncRNA FAM99A/FAM99B in hepatocellular carcinoma:

Expressions, regulatory mechanisms and functional pathway analysis. Life Sci. 2024;349:122710. Article  CAS  PubMed  Google Scholar  * Xu G, Ban K, Mu H, Wang B. Human umbilical cord

mesenchymal stem cells-derived exosomal lncRNA FAM99B represses hepatocellular carcinoma cell malignancy. Mol Biotechnol. 2024;66:1389–401. Article  CAS  PubMed  Google Scholar  * Song C,

Hotz-Wagenblatt A, Voit R, Grummt I. SIRT7 and the DEAD-box helicase DDX21 cooperate to resolve genomic R loops and safeguard genome stability. Genes Dev. 2017;31:1370–81. Article  CAS 

PubMed  PubMed Central  Google Scholar  * Calo E, Flynn RA, Martin L, Spitale RC, Chang HY, Wysocka J. RNA helicase DDX21 coordinates transcription and ribosomal RNA processing. Nature.

2015;518:249–53. Article  CAS  PubMed  Google Scholar  * Huang Y, Zheng S, Guo Z, de Mollerat du Jeu X, Liang XJ, Yang Z, et al. Ionizable liposomal siRNA therapeutics enables potent and

persistent treatment of Hepatitis B. Signal Transduct Target Ther. 2022;7:38. Article  CAS  PubMed  PubMed Central  Google Scholar  * Yang H, Zhou J, Ochs RL, Henning D, Jin R, Valdez BC.

Down-regulation of RNA helicase II/Gu results in the depletion of 18 and 28 S rRNAs in Xenopus oocyte. J Biol Chem. 2003;278:38847–59. Article  CAS  PubMed  Google Scholar  * Zhang Y, Baysac

KC, Yee LF, Saporita AJ, Weber JD. Elevated DDX21 regulates c-Jun activity and rRNA processing in human breast cancers. Breast Cancer Res. 2014;16:449. Article  PubMed  PubMed Central 

Google Scholar  * Cao J, Wu N, Han Y, Hou Q, Zhao Y, Pan Y, et al. DDX21 promotes gastric cancer proliferation by regulating cell cycle. Biochem Biophys Res Commun. 2018;505:1189–94. Article

  CAS  PubMed  Google Scholar  * Santoriello C, Sporrij A, Yang S, Flynn RA, Henriques T, Dorjsuren B, et al. RNA helicase DDX21 mediates nucleotide stress responses in neural crest and

melanoma cells. Nat Cell Biol. 2020;22:372–9. Article  CAS  PubMed  PubMed Central  Google Scholar  * Gao H, Wei H, Yang Y, Li H, Liang J, Ye J, et al. Phase separation of DDX21 promotes

colorectal cancer metastasis via MCM5-dependent EMT pathway. Oncogene. 2023;42:1704–15. Article  CAS  PubMed  PubMed Central  Google Scholar  * Putra V, Hulme AJ, Tee AE, Sun JQJ,

Atmadibrata B, Ho N, et al. The RNA-helicase DDX21 upregulates CEP55 expression and promotes neuroblastoma. Mol Oncol. 2021;15:1162–79. Article  CAS  PubMed  PubMed Central  Google Scholar 

* Aksu M, Pleiner T, Karaca S, Kappert C, Dehne HJ, Seibel K, et al. Xpo7 is a broad-spectrum exportin and a nuclear import receptor. J Cell Biol. 2018;217:2329–40. Article  CAS  PubMed 

PubMed Central  Google Scholar  * Wu W, Qu Y, Yu S, Wang S, Yin Y, Liu Q, et al. Caspase-dependent cleavage of DDX21 suppresses host innate immunity. mBio. 2021;12:e0100521. Article  PubMed

  Google Scholar  * Blobel G, Sabatini D. Dissociation of mammalian polyribosomes into subunits by puromycin. Proc Natl Acad Sci USA. 1971;68:390–4. Article  CAS  PubMed  PubMed Central 

Google Scholar  * Sehgal A, Barros S, Ivanciu L, Cooley B, Qin J, Racie T, et al. An RNAi therapeutic targeting antithrombin to rebalance the coagulation system and promote hemostasis in

hemophilia. Nat Med. 2015;21:492–7. Article  CAS  PubMed  Google Scholar  * Smekalova EM, Kotelevtsev YV, Leboeuf D, Shcherbinina EY, Fefilova AS, Zatsepin TS, et al. lncRNA in the liver:

prospects for fundamental research and therapy by RNA interference. Biochimie. 2016;131:159–72. Article  CAS  PubMed  Google Scholar  * Xu G, Ban K, Mu H & Wang B. Human umbilical cord

mesenchymal stem cells-derived exosomal lncRNA FAM99B represses hepatocellular carcinoma cell malignancy. Mol Biotechnol. 2023;66:1389–1401. * Schmidt HB, Gorlich D. Transport selectivity of

nuclear pores, phase separation, and membraneless organelles. Trends Biochem Sci. 2016;41:46–61. Article  CAS  PubMed  Google Scholar  * Jamali T, Jamali Y, Mehrbod M, Mofrad MR. Nuclear

pore complex: biochemistry and biophysics of nucleocytoplasmic transport in health and disease. Int Rev Cell Mol Biol. 2011;287:233–86. Article  CAS  PubMed  Google Scholar  * Wing CE, Fung

HYJ, Chook YM. Karyopherin-mediated nucleocytoplasmic transport. Nat Rev Mol Cell Biol. 2022;23:307–28. Article  CAS  PubMed  PubMed Central  Google Scholar  * Wang AY, Liu H. The past,

present, and future of CRM1/XPO1 inhibitors. Stem Cell Investig. 2019;6:6. Article  CAS  PubMed  PubMed Central  Google Scholar  * Zhao K, Guo XR, Liu SF, Liu XN, Han Y, Wang LL, et al. 2B

and 3C proteins of senecavirus A antagonize the antiviral activity of DDX21 via the caspase-dependent degradation of DDX21. Front Immunol. 2022;13:951984. Article  CAS  PubMed  PubMed

Central  Google Scholar  * Henning D, So RB, Jin R, Lau LF, Valdez BC. Silencing of RNA helicase II/Gualpha inhibits mammalian ribosomal RNA production. J Biol Chem. 2003;278:52307–14.

Article  CAS  PubMed  Google Scholar  * Sloan KE, Leisegang MS, Doebele C, Ramirez AS, Simm S, Safferthal C, et al. The association of late-acting snoRNPs with human pre-ribosomal complexes

requires the RNA helicase DDX21. Nucleic Acids Res. 2015;43:553–64. Article  CAS  PubMed  Google Scholar  * Lavergne G, Roignant JY. DDX21: The link between m(6)A and R-loops. Mol Cell.

2024;84:1631–2. Article  CAS  PubMed  Google Scholar  * Xing YH, Yao RW, Zhang Y, Guo CJ, Jiang S, Xu G, et al. SLERT regulates DDX21 rings associated with pol I transcription. Cell.

2017;169:664–78 e616. Article  CAS  PubMed  Google Scholar  * Brown CR, Gupta S, Qin J, Racie T, He G, Lentini S, et al. Investigating the pharmacodynamic durability of GalNAc-siRNA

conjugates. Nucleic Acids Res. 2020;48:11827–44. Article  CAS  PubMed  PubMed Central  Google Scholar  * Yu J, Zhu C, Wang X, Kim K, Bartolome A, Dongiovanni P, et al. Hepatocyte TLR4

triggers inter-hepatocyte jagged1/notch signaling to determine NASH-induced fibrosis. Sci Transl Med. 2021;13:eabe1692. * Balwani M, Sardh E, Ventura P, Peiro PA, Rees DC, Stolzel U, et al.

Phase 3 trial of RNAi therapeutic givosiran for acute intermittent porphyria. N Engl J Med. 2020;382:2289–301. Article  CAS  PubMed  Google Scholar  * Garrelfs SF, Frishberg Y, Hulton SA,

Koren MJ, O’Riordan WD, Cochat P, et al. Lumasiran, an RNAi therapeutic for primary hyperoxaluria type 1. N Engl J Med. 2021;384:1216–26. Article  CAS  PubMed  Google Scholar  * Ray KK,

Wright RS, Kallend D, Koenig W, Leiter LA, Raal FJ, et al. Two phase 3 trials of inclisiran in patients with elevated LDL cholesterol. N Engl J Med. 2020;382:1507–19. Article  CAS  PubMed 

Google Scholar  * Paunovska K, Loughrey D, Dahlman JE. Drug delivery systems for RNA therapeutics. Nat Rev Genet. 2022;23:265–80. Article  CAS  PubMed  PubMed Central  Google Scholar  * Liu

Y, Wang Y, Liu B, Liu W, Ma Y, Cao Y, et al. Targeting lncRNA16 by GalNAc-siRNA conjugates facilitates chemotherapeutic sensibilization via the HBB/NDUFAF5/ROS pathway. Sci China Life Sci.

2024;67:663–79. Article  CAS  PubMed  Google Scholar  * Gao Y, Tong M, Wong TL, Ng KY, Xie YN, Wang Z, et al. Long noncoding RNA URB1-antisense RNA 1 (AS1) suppresses sorafenib-induced

ferroptosis in hepatocellular carcinoma by driving ferritin phase separation. ACS Nano. 2023;17:22240–58. Article  CAS  PubMed  Google Scholar  * Li Y, Tan Z, Zhang Y, Zhang Z, Hu Q, Liang

K, et al. A noncoding RNA modulator potentiates phenylalanine metabolism in mice. Science. 2021;373:662–73. Article  CAS  PubMed  PubMed Central  Google Scholar  Download references

ACKNOWLEDGEMENTS This work was supported by grants from the National Natural Science Foundation of China (82121004, 81930123, 82472626). AUTHOR INFORMATION Author notes * These authors

contributed equally: Yifei He, Hongquan Li. AUTHORS AND AFFILIATIONS * Fudan University Shanghai Cancer Center and Institutes of Biomedical Sciences; Department of Oncology, Shanghai Medical

College, Fudan University, Shanghai, 200032, China Yifei He, Hongquan Li, Qili Shi, Yanfang Liu, Qiaochu Pan & Xianghuo He * Key Laboratory of Breast Cancer in Shanghai, Fudan

University Shanghai Cancer Center, Fudan University, Shanghai, 200032, China Xianghuo He Authors * Yifei He View author publications You can also search for this author inPubMed Google

Scholar * Hongquan Li View author publications You can also search for this author inPubMed Google Scholar * Qili Shi View author publications You can also search for this author inPubMed 

Google Scholar * Yanfang Liu View author publications You can also search for this author inPubMed Google Scholar * Qiaochu Pan View author publications You can also search for this author

inPubMed Google Scholar * Xianghuo He View author publications You can also search for this author inPubMed Google Scholar CONTRIBUTIONS XH, YH, and HL conceived and designed the study. YH,

HL, and QP performed the experiments. YH and QS processed the data. YH, HL, and XH wrote and revised the manuscript. All the authors read and approved the final manuscript. CORRESPONDING

AUTHORS Correspondence to Hongquan Li or Xianghuo He. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing interests. ETHICS APPROVAL AND CONSENT TO PARTICIPATE All

animal experiments were performed in accordance with the institutional guidelines of the Institutional Animal Care and Use Committee of Fudan University Shanghai Cancer Center (permission

number: FUSCC-IACUC-2023228), Shanghai, China. All participants in this study provided informed consent. ADDITIONAL INFORMATION PUBLISHER’S NOTE Springer Nature remains neutral with regard

to jurisdictional claims in published maps and institutional affiliations. Edited by Barak Rotblat SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION TABLE S1 TABLE S2 FULL AND UNCROPPED

WESTERN BLOTS RIGHTS AND PERMISSIONS OPEN ACCESS This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution

and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if

changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the

material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to

obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS

ARTICLE He, Y., Li, H., Shi, Q. _et al._ The liver-specific long noncoding RNA FAM99B inhibits ribosome biogenesis and cancer progression through cleavage of dead-box Helicase 21. _Cell

Death Dis_ 16, 97 (2025). https://doi.org/10.1038/s41419-025-07401-w Download citation * Received: 12 August 2024 * Revised: 09 January 2025 * Accepted: 27 January 2025 * Published: 14

February 2025 * DOI: https://doi.org/10.1038/s41419-025-07401-w SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a

shareable link is not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative