ABSTRACT The newly emerging coronavirus SARS-CoV-2 causes severe lung disease and substantial mortality. How the virus evades host defense for efficient replication is not fully understood.

In this report, we found that the SARS-CoV-2 nucleocapsid protein (NP) impaired stress granule (SG) formation induced by viral RNA. SARS-CoV-2 NP associated with the protein kinase PKR after

dsRNA stimulation. SARS-CoV-2 NP did not affect dsRNA-induced PKR oligomerization, but impaired dsRNA-induced PKR phosphorylation (a hallmark of its activation) as well as SG formation.

SARS-CoV-2 NP also targeted the SG-nucleating protein G3BP1 and impaired G3BP1-mediated SG formation. Deficiency of PKR or G3BP1 impaired dsRNA-triggered SG formation and increased

pathogenic human betacoronaviruses. SIMILAR CONTENT BEING VIEWED BY OTHERS SARS-COV-2 INFECTION INDUCES DNA DAMAGE, THROUGH CHK1 DEGRADATION AND IMPAIRED 53BP1 RECRUITMENT, AND CELLULAR

SENESCENCE Article Open access 09 March 2023 SARS-COV-2 ORF6 DISRUPTS NUCLEOCYTOPLASMIC TRAFFICKING TO ADVANCE VIRAL REPLICATION Article Open access 19 May 2022 PERTURBATION OF THE HOST CELL

CA2+ HOMEOSTASIS AND ER-MITOCHONDRIA CONTACT SITES BY THE SARS-COV-2 STRUCTURAL PROTEINS E AND M Article Open access 29 April 2023 INTRODUCTION Coronaviruses are enveloped viruses that

contain positive sense, non-segmented, single-stranded RNA genomes1,2. So far, seven human coronaviruses have been identified, including HCoV-229E, HCoV-NL63, HCoV-OC43, HCoV-HKU1, SARS-CoV,

MERS-CoV, and SARS-CoV-21,2,3,4. Recently, SARS-CoV-2 has caused a pandemic of acute respiratory syndromes called COVID-19 in humans5,6,7. SARS-CoV-2 belongs to _Betacoronavirus_, and its

genome sequence shares 79% identity with SARS-CoV and 50% with MERS-CoV8. The genome of SARS-CoV-2 codes for 16 nonstructural proteins (nsp1–nsp16) required for viral replication and

pathogenesis, 8 auxiliary proteins (ORF3a, ORF3b, ORF6, ORF7a, ORF7b, ORF8, ORF9b, and ORF14), and 4 structural proteins (S, E, M, and N)3,9. Previous studies have demonstrated that

SARS-CoV-2 uses the same receptor angiotensin-converting enzyme 2 (ACE2) as SARS-CoV to enter the cell via its S protein6,10. Recently, it has been reported that SARS-CoV-2 suppresses host

immune responses at the early phase of infection, while activates a persistent inflammatory response at the late phase, resulting in cytokine storm and organ damage11. Stress granules (SGs)

are non-membranous electron-dense cytoplasmic structures/foci enriched with untranslated mRNAs. The formation and dissolvement of SGs are highly dynamic12. Formation of SGs can be induced

upon cellular stress, such as nutrient deprivation, heat shock, UV radiation, arsenite treatment, and viral infection13,14. Upon viral infection, viral double-strand RNA (dsRNA) or

5′-triphosphate RNA, which are common intermediates of viral replication, binds to the protein kinase PKR, leading to conformational changes that release the C-terminal kinase domain from

the N-terminal RNA-binding domain (RBD). The released kinase domain dimerizes or oligomerizes, resulting in autophosphorylation and activation. The activated PKR phosphorylates the

eukaryotic translation initiation factor eIF2α, triggering Ras-GAP SH3 domain-binding protein (G3BP)- and T-cell-restricted intracellular antigen 1 (TIA-1)-dependent assembly of

untranslational mRNA-enriched SGs15,16. Because phosphorylated eIF2α is hindered to form tRNAMet-GTP–eIF2 complex, synthesis of both cellular and viral proteins in the SGs is impaired

following infection15,16,17. It has been demonstrated that the induction of SGs after viral infection acts as a host antiviral strategy18,19. In addition to the blockade of viral gene

expression by initiating translation arrest, SGs also sequester viral factors in the granules to inhibit their functions. In addition, linkage between SGs and the induction of type I IFNs

has also been suggested. Certain viruses have evolved strategies to antagonize SG formation to promote their replication20,21,22,23. Although several mechanisms on evasion of host defense by

SARS-CoV-2 have been reported24, it is unknown whether SG formation is targeted by SARS-CoV-2. In this study, we found that SARS-CoV-2 nucleocapsid protein (NP) impaired SG formation by

inhibiting PKR autophosphorylation and activation, as well as by targeting the SG-nucleating component G3BP1. Deficiency of PKR or G3BP1 promoted replication of SARS-CoV-2. Moreover, the NP

of SARS-CoV also inhibited both PKR and G3BP1, whereas MERS-CoV NP only targeted PKR. These findings reveal a relatively conserved mechanism of evasion of host defense by highly pathogenic

human betacoronaviruses. RESULTS SARS-COV-2 EVOLVES STRATEGIES TO ANTAGONIZE FORMATION OF SGS Previously, it has been demonstrated that formation of SGs acts as an important strategy for the

host cell to antagonize viral replication14,18,19. We attempted to determine whether this antiviral strategy also functions to antagonize SARS-CoV-2 replication. We firstly examined SG

formation in ACE2-expressing HeLa (HeLa-ACE2) cells infected with SARS-CoV-2, transfected with SARS-CoV-2 RNA or the synthetic RNA analog poly(I:C). As shown in Fig. 1a, sodium arsenite,

which induces oxidative stress25, triggered formation of TIA-1 and G3BP1 double-positive SGs in the cytoplasm. In these experiments, transfection of SARS-CoV-2 RNA or poly(I:C) also induced

the formation of TIA-1/G3BP1-positive SGs (Fig. 1a). However, TIA-1/G3BP1-positive SGs were not observed at all examined time points post SARS-CoV-2 infection (Fig. 1b). Moreover, sodium

arsenite-induced formation of SGs were blocked in SARS-CoV-2-infected cells (Fig. 1b). The simplest explanation for these results is that formation of SGs is impaired by SARS-CoV-2. It has

been demonstrated that binding of viral RNA to PKR results in its autophosphorylation and subsequent eIF2α–G3BP1-mediated formation of SGs26,27, whereas sodium arsenite induces

eIF2α–G3BP1-mediated SG formation via another kinase HRI and thus is PKR independent. Consistently, while transfection of SARS-CoV-2 RNA, poly(I:C), and sodium arsenite treatment all induced

eIF2α phosphorylation, only SARS-CoV-2 RNA- and poly(I:C)-transfection but not sodium arsenite treatment enhanced PKR phosphorylation (Fig. 1c). Notably, SARS-CoV-2 infection barely induced

phosphorylation of PKR and eIF2α, and had no effects on sodium arsenite-induced phosphorylation of eIF2α (Fig. 1d). Taken together, these results suggest that SARS-CoV-2 antagonizes

PKR–eIF2α-mediated SG formation. We then examined the involvement of PKR and G3BP1 in viral RNA-induced formation of SGs. Knockout of PKR by the CRISPR/Cas9 method impaired SG formation

induced by transfection of poly(I:C) or SARS-CoV-2 RNA, but not by sodium arsenite treatment (Fig. 1e, f), which was consistent with previous reports that oxidative stress induces SG

formation independently of PKR. However, knockout of G3BP1 impaired SG formation induced by transfection of poly(I:C) or SARS-CoV-2 RNA, as well as by sodium arsenite treatment (Fig. 1e, g).

These results suggest that PKR and G3BP1 are indispensable for SARS-CoV-2 RNA-induced SG formation. INHIBITION OF SG FORMATION PROMOTES SARS-COV-2 REPLICATION SG formation is a cellular

stress response to certain RNA viruses, such as hepatitis C virus (HCV) and ZIKV, resulting in the inhibition of viral replication20,28,29. We next examined the roles of SGs in SARS-CoV-2

replication. We found that knockdown of PKR or G3BP1 significantly enhanced replication of SARS-CoV-2 genome in HeLa-ACE2 cells (Fig. 2a, b). Furthermore, production of progeny virus in PKR-

or G3BP1-knockdown cells was significantly increased in comparison with the control cells (Fig. 2c). Consistently, the level of viral protein NP, which is another marker for viral

replication, was also higher in PKR- and G3BP1-knockdown cells following SARS-CoV-2 infection (Fig. 2d). Taken together, these results suggest that PKR–G3BP1-mediated SG formation suppresses

replication of SARS-CoV-2. SARS-COV-2 NP INHIBITS SG FORMATION BY TARGETING BOTH PKR AND G3BP1 We next investigated the mechanisms responsible for impairment of SG formation by SARS-CoV-2.

We screened for SARS-CoV-2 proteins that could inhibit poly(I:C)-induced formation of G3BP1-positive foci. The results indicated that SARS-CoV-2 NP, but not the other six examined viral

proteins inhibited the formation of G3BP1-positive foci induced by transfected poly(I:C) (Fig. 3a, b). Overexpression of NP also inhibited formation of G3BP1-positive foci induced by

transfection of SARS-CoV-2 RNA or sodium arsenite treatment (Fig. 3c). These results suggest that SARS-CoV-2 NP impairs viral RNA- and sodium arsenite-induced SG formation. Since PKR and

G3BP1 play critical roles in viral RNA-induced SG assembly, we examined whether SARS-CoV-2 NP could interact with them. Co-immunoprecipitation experiments indicated that NP associated with

PKR in mammalian overexpression systems (Fig. 4a). Further experiments indicated that NP associated with endogenous PKR after poly(I:C) transfection (Fig. 4b). Moreover, their association

was blocked by RNase A treatment (Fig. 4b), suggesting that the interaction between NP and PKR is RNA dependent. Notably, overexpression of NP did not affect PKR oligomerization induced by

transfected poly(I:C), but impaired phosphorylation of PKR and eIF2α, the hallmarks of PKR activation (Fig. 4c). Previously, it has been shown that viral RNA induces SGs via the

PKR–eIF2α–G3BP1/2 pathway, whereas sodium arsenite induces SGs via the HRI–eIF2α–G3BP1/2 axis30. In our study, we found that while NP inhibited poly(I:C)-triggered phosphorylation of eIF2α

(Fig. 4c), it showed no effects on sodium arsenite-induced eIF2α phosphorylation (Fig. 4d), suggesting an inhibitory role of NP on PKR. Recent proteomics analysis has shown that SARS-CoV-2

NP interacts with the SG core components G3BP1 and G3BP2, as well as other RNA-binding proteins31,32. Co-immunoprecipitation experiments confirmed the interaction between NP and endogenous

G3BP1 (Fig. 4e), which is consistent with the results that overexpression of NP, as well as SARS-CoV-2 infection also impaired arsenite-induced SG formation, which is G3BP1 but not PKR

dependent (Figs. 1b and 3c). These findings indicated that NP antagonizes SARS-CoV-2 RNA-induced SG formation by targeting both PKR and G3BP1. We next further investigated which region(s) of

SARS-CoV-2 NP play key roles in the inhibition of PKR-mediated SG formation. NP consists of an N-terminal RBD (aa 45–180), a serine/arginine-rich motif (aa 176–207), a linker region (aa

208–284), and a C-terminal self-association domain (SAD, aa 285–419), which contains a nuclear localization sequence (aa 372–389)33. As shown in Fig. 4f, the C-terminus of NP that contains

the linker region and the SAD was essential for the impairment of PKR and eIF2α phosphorylation induced by poly(I:C). Consistently, truncations lacking the C-terminal linker or SAD domain

(NPΔ207–284 or NPΔSAD) failed to inhibit poly(I:C)-induced formation of G3BP1-positive foci, suggesting that the C-terminus of NP plays a critical role in the suppression of SG formation

(Fig. 4g). THE NPS OF SARS-COV AND MERS-COV SUPPRESS SG FORMATION Comparison of the C-terminus of NPs of SARS-CoV, SARS-CoV-2, and MERS-CoV showed that the amino acid sequences of NPs of

SARS-CoV and SARS-CoV-2 are relatively conserved, but divergent from that of MERS-CoV (Fig. 5a). We then investigated whether the NPs of SARS-CoV and MERS-CoV play similar roles in

suppression of SG formation. Similar to SARS-CoV-2 NP, the NPs of SARS-CoV and MERS-CoV interacted weakly with endogenous PKR in the absence of poly(I:C), and the interactions were enhanced

following poly(I:C) stimulation and blocked by RNase A treatment (Fig. 5b). Consistently, NPs of the three coronaviruses all inhibited poly(I:C)-triggered phosphorylation of PKR and eIF2α

(Fig. 5c). Interestingly, NPs of SARS-CoV, SARS-CoV-2 but not MERS-CoV interacted with G3BP1 (Fig. 5d). Further investigation revealed that NPs of SARS-CoV-2 and SARS-CoV inhibited SG

formation induced by both poly(I:C) and sodium arsenite (Fig. 5e). However, MERS-CoV NP only inhibited poly(I:C)-, but not sodium arsenite-induced formation of G3BP1-positive foci in the

cytoplasm (Fig. 5e). These results suggest that the NPs of SARS-CoV-2 and SARS-CoV impair formation of SGs by targeting both PKR and G3BP1, whereas MERS-CoV NP targets PKR, but not G3BP1

(Fig. 6). DISCUSSION Viral RNA-triggered, PKR–eIF2α–G3BP1-induced SGs are considered to be antiviral structures during viral infection34. Several mechanisms have been proposed for viral

proteins to antagonize SG-mediated antiviral defense. MERS-CoV protein 4a sequesters viral RNA and prevents its binding to PKR, resulting in the inhibition of SG formation21,22. HCV NS5A,

Japanese encephalitis virus NS2A, and Sendai virus C protein target PKR to inhibit antiviral SG formation35,36,37,38. Enterovirus (EV) 71 protease 3Cpro cleaves G3BP1 at amino acid Q326,

resulting in disassembly of SGs following EV71 infection39. Similar mechanisms are observed for poliovirus, foot-and-mouse disease virus, feline calicivirus, and encephalomyocarditis

virus40,41,42,43. In addition, picornavirus 2Apro blocks typical SGs and induces atypical SGs via cleavage of eIF4GI to sequester cellular mRNA, but release viral mRNA34. In this study, our

findings suggest that SARS-CoV-2 NP impairs viral RNA-induced SG formation. Overexpression of SARS-CoV-2 NP inhibited SG formation triggered by transfected SARS-CoV-2 RNA or the RNA analog

poly(I:C) (Fig. 3c). Mechanistic studies indicated that SARS-CoV-2 NP associated with the protein kinase PKR after poly(I:C) stimulation (Fig. 4a, b). It has been previously reported that

PKR is activated in multiple steps27,44. In resting sate, PKR exists as inactive monomer and the kinase activity is autoinhibited by its N-terminal regulatory region, which includes two

RBDs27,45,46. Upon dsRNA binding to RBDs, PKR undergoes conformational change, resulting in relief of autoinhibition and dimerization/oligomerization27,47. Substantially,

dimerized/oligomerized PKR mediates trans-interdimer autophosphorylation at T446, which is required for its activation and recognition of the substrate eIF2α27,44,48. In our experiments, we

found that NP interacted with PKR, inhibited autophosphorylation of PKR at T446, but not PKR dimerization/oligomerization (Fig. 4c). The simplest explanation is that the interaction of NP

with PKR blocks the phosphorylation site (T446) of PKR, resulting in impaired trans-interdimer autophosphorylation. In addition to PKR, NP also interacts with the SG-nucleating protein G3BP1

(Fig. 4e) and impaired G3BP1-mediated SG formation (Fig. 3c), suggesting that SARS-CoV-2 NP targets multiple steps in SG formation. Deficiency of PKR or G3BP1 impaired poly(I:C)- or

SARS-CoV-2 RNA-triggered SG formation (Fig. 1f, g), and increased SARS-CoV-2 replication (Fig. 2). These results suggest that impairment of SGs by the NP of SARS-CoV-2 represents an

important mechanism for its evasion of host defense. Domain mapping analysis of SARS-CoV-2 NP showed that its C-terminus (aa 207–419) is essential for the impairment of SG formation (Fig.

4f, g). Alignment of the C-terminus of NPs of SARS-CoV, SARS-CoV-2, and MERS-CoV revealed that SARS-CoV and SARS-CoV-2 are relatively conserved, but divergent from that of MERS-CoV. Further

investigation indicated that the NP of SARS-CoV also targeted both PKR and G3BP1 to impair dsRNA-induced SG formation, whereas the NP of MERS-CoV targeted PKR, but not G3BP1 for the

impairment (Fig. 5b–e). These results suggest that the roles of NPs of these coronaviruses in evasion of host defense are conserved, but not totally the same. In conclusion, our findings

suggest that SARS-CoV-2 NP promotes viral replication by impairing formation of antiviral SGs, and reveal a conserved mechanism on evasion of host antiviral responses by highly pathogenic

human betacoronaviruses (Fig. 6). MATERIALS AND METHODS REAGENTS, ANTIBODIES, CELLS, AND VIRUSES Lipofectamine 2000 (Invitrogen); FuGene (Promega); puromycin (Thermo Fisher); SYBR Green

Supermix (BIO-RAD); polybrene (Millipore); Protein G sepharose (GE Healthcare); mouse antibodies against Flag and β-actin (Sigma-Aldrich); HA (OriGene); β-tubulin and SARS-CoV-2 NP (Cell

Signaling Technology); TIA-1 (Santa Cruz Biotechnology); rabbit antibodies against HA, eIF2α, and phosphor-eIF2α (Ser51) (Cell Signaling Technology); PKR and phosphor-PKR (T446); G3BP2

(Abcam); and G3BP1 (ABclonal) were purchased from the indicated companies. HEK293T, Vero E6, and HeLa cells were purchased from ATCC. HeLa-ACE2 cells (stably expressing ACE2) were

constructed by lentiviral-mediated transduction. Cells were cultured in DMEM (Hyclone) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin–streptomycin (Thermo Fisher

Scientific) at 37 °C with 5% CO2. SARS-CoV-2 (IVCAS 6.7512) was isolated from BALF collected from a patient with viral pneumonia in December of 2019 in Wuhan, China6. The virus was

propagated in Vero E6 cells49. SARS-CoV-2 RNA was isolated from Vero E6 cells infected with SARS-CoV-2 for 48 h. All SARS-CoV-2-related experiments were performed in the biosafety level 3

(BSL-3) laboratory of Wuhan Institute of Virology. PLASMIDS Mammalian expression plasmids for Flag- or HA-tagged SARS-CoV-2 NP and its truncations, SARS-CoV NP, MERS-CoV NP, and PKR were

constructed by standard molecular biology techniques. TRANSFECTION HeLa cells were transfected by FuGene and lipofectamine 2000. HEK293T cells were transfected by standard calcium phosphate

precipitation method. Control plasmids were added to ensure that each transfection receives the same amount of total DNA. STABLE CELL LINES HEK293T cells were transfected with two packaging

plasmids (pSPAX2 (7.5 μg) and pMD2.G (5 μg)) together with empty vector, or the indicated plasmids (10 μg) by calcium phosphate precipitation. Twelve hours later, the medium was replaced.

Thirty-six hours later, the recombinant virus-containing medium was filtered (0.45 μm) and added to HeLa cells in the presence of polybrene (8 μg/mL). Twenty-four hours post infection, cells

were selected with puromycin (0.5 μg/mL) for 7 days before experiments. QPCR Total RNAs were isolated from cells and reverse-transcribed to cDNA for qPCR analysis to measure mRNA levels of

the indicated genes. Data shown are the relative abundance of the indicated mRNA normalized to that of GAPDH. Primer sequences for qPCR assays were as follows: human _GAPDH_,

GAGTCAACGGATTTGGTCGT and GACAAGCTTCCCGTTCTCAG; SARS-CoV-2 _S_, CTTCCCTCAGTCAGCACCTC and AACCAGTGTGTGCCATTTGA; SARS-CoV-2 _M_, AATTTGCCTATGCCAACAGG and GTACGCGCAAACAGTCTGAA; SARS-CoV-2 _E_,

TCGTTTCGGAAGAGACAGGT and CACGAGAGTAAACGTAAAAAGAAGG; SARS-CoV-2 _N_, CATTGGCATGGAAGTCACAC and TCTGCGGTAAGGCTTGAGTT. MEASUREMENT OF SARS-COV-2 VIRAL TITER Cell culture supernatant of

SARS-CoV-2-infected HeLa-ACE2 cells was harvested, and viral RNA was extracted using the MiniBEST Viral RNA/DNA Extraction Kit (Takara)6,50. Viral RNA was eluted with RNase-free water and

reverse-transcribed to cDNA for qRT-PCR. A standard curve was generated by serial dilutions (103–109 copies) of the plasmids encoding RBD of the SARS-CoV-2 Spike gene. The level of

SARS-CoV-2 Spike gene in the cell culture supernatant was then determined by qPCR and further converted to the viral titer, as previously described6,50. The primers used for the SARS-CoV-2

Spike gene RBD were: 5′-CAATGGTTTAACAGGCACAGG-3′ and 5′-CTCAAGTGTCTGTGGATCACG-3′6,50. CO-IMMUNOPRECIPITATION AND IMMUNOBLOT ANALYSIS HEK293T cells (5 × 106) were lysed with 1 mL pre-lysis

buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 10 μg/mL aprotinin, 10 μg/mL leupeptin, and 1 mM phenylmethylsulfonyl fluoride) for 30 min on ice. Cell lysates were

clarified by centrifugation at 4 °C, 12,000 r.p.m. for 15 min. For each immunoprecipitation, the lysate (400 μL) was incubated with the indicated antibodies (0.5 μg each) and protein G

sepharose beads (25 μL) at 4 °C for 3–5 h. The protein-bound beads were then collected and washed three times with 1 mL of lysis buffer containing 0.5 M NaCl. Immunoblot analysis was

performed by standard procedures. CONFOCAL MICROSCOPY HeLa cells were transfected with the indicated plasmids by FuGene. After transfection for 20 h, the cells were stimulated with sodium

arsenite for 1 h or transfected with poly(I:C) and SARS-CoV-2 RNA by lipo2000 for 10 h. The cells were fixed with 4% paraformaldehyde for 10–15 min on ice and washed with PBS for three

times, then permeabilized with 0.3% Triton X-100 on ice for 10 min and blocked in 1% BSA for 20 min at room temperature. The cells were then incubated with the indicated primary antibodies

overnight at 4 °C. Alexa Fluor 488- and 555-conjugated secondary antibodies were incubated with the cells for 1 h. The nuclei were stained with DAPI for 2 min before images were acquired

using Nikon confocal microscope under a 60× oil lens objective. PKR OLIGOMERIZATION ASSAY Analysis of PKR oligomerization was performed, as described previously51. HEK293T cells were lysed

in 100 μL PBS containing 0.5% Triton X-100 and incubated for at least 10 min at 4 °C. Cell lysates were clarified by centrifugation at 4 °C, 10,000× _g_ for 10 min. An aliquot of cell lysate

(10 μL) was mixed with 5× native sample buffer (250 mM Tris-HCl, pH 6.8, 1% sodium deoxycholate, 50% glycerol, and 0.5% bromophenol blue) or 2× SDS loading buffer. The samples were analyzed

by native PAGE or SDS–PAGE, respectively. The native PAGE was run at 4 °C with anode buffer (50 mM Tris-HCl, pH 9.0 and 384 mM glycine) and cathode buffer (50 mM Tris-HCl, pH 8.3, 384 mM

glycine, and 1% sodium deoxycholate) at 20 mA per gel. The proteins were transferred to immobilon membrane (Millipore) by standard procedures with Towbin buffer (25 mM Tris, 192 mM glycine,

0.1% SDS, and 20% methanol) at 250 mA for 1.5 h at 4 °C. Immunoblot analysis was performed by standard procedures. The SDS–PAGE was performed by standard procedures. STATISTICS Unpaired

Student’s _t-_test was used for statistical analysis with GraphPad Prism Software; *_P_ < 0.05 and **_P_ < 0.01 were considered significant. REFERENCES * Fehr, A. R. & Perlman, S.

Coronaviruses: an overview of their replication and pathogenesis. _Methods Mol. Biol._ 1282, 1–23 (2015). Article  CAS  PubMed  PubMed Central  Google Scholar  * Fung, T. S. & Liu, D. X.

Human coronavirus: host-pathogen interaction. _Annu Rev. Microbiol_ 73, 529–557 (2019). Article  CAS  PubMed  Google Scholar  * Wu, A. et al. Genome composition and divergence of the novel

coronavirus (2019-nCoV) originating in China. _Cell Host Microbe_ 27, 325–328 (2020). Article  CAS  PubMed  PubMed Central  Google Scholar  * Coronaviridae Study Group of the International

Committee on Taxonomy of, V. The species severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2. _Nat. Microbiol_ 5, 536–544 (2020). Article 

CAS  Google Scholar  * Chen, Y., Liu, Q. & Guo, D. Emerging coronaviruses: genome structure, replication, and pathogenesis. _J. Med. Virol._ 92, 418–423 (2020). Article  CAS  PubMed 

PubMed Central  Google Scholar  * Zhou, P. et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. _Nature_ 579, 270–273 (2020). Article  CAS  PubMed  PubMed

Central  Google Scholar  * Huang, C. L. et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. _Lancet_ 395, 497–506 (2020). Article  CAS  PubMed  PubMed

Central  Google Scholar  * Hu, B., Guo, H., Zhou, P. & Shi, Z. L. Characteristics of SARS-CoV-2 and COVID-19. _Nat. Rev. Microbiol._ 19, 141–154 (2020). Article  PubMed  CAS  PubMed

Central  Google Scholar  * V’Kovski, P., Kratzel, A., Steiner, S., Stalder, H. & Thiel, V. Coronavirus biology and replication: implications for SARS-CoV-2. _Nat. Rev. Microbiol_ 19,

155–170 (2021). Article  PubMed  CAS  Google Scholar  * Hoffmann, M. et al. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. _Cell_

181, 271–27 (2020). Article  CAS  PubMed  PubMed Central  Google Scholar  * Tian, W. et al. Immune suppression in the early stage of COVID-19 disease. _Nat. Commun._ 11, 5859 (2020).

Article  CAS  PubMed  PubMed Central  Google Scholar  * Protter, D. S. W. & Parker, R. Principles and properties of stress granules. _Trends Cell Biol._ 26, 668–679 (2016). Article  CAS

  PubMed  PubMed Central  Google Scholar  * Mahboubi, H. & Stochaj, U. Cytoplasmic stress granules: dynamic modulators of cell signaling and disease. _Biochim. Biophys. Acta Mol. Basis

Dis._ 1863, 884–895 (2017). Article  CAS  PubMed  Google Scholar  * White, J. P. & Lloyd, R. E. Regulation of stress granules in virus systems. _Trends Microbiol_ 20, 175–183 (2012).

Article  CAS  PubMed  PubMed Central  Google Scholar  * Matsuki, H. et al. Both G3BP1 and G3BP2 contribute to stress granule formation. _Genes Cells_ 18, 135–146 (2013). Article  CAS  PubMed

  Google Scholar  * Gilks, N. et al. Stress granule assembly is mediated by prion-like aggregation of TIA-1. _Mol. Biol. Cell_ 15, 5383–5398 (2004). Article  CAS  PubMed  PubMed Central 

Google Scholar  * Liu, Y. et al. The role of host eIF2alpha in viral infection. _Virol. J._ 17, 112 (2020). Article  CAS  PubMed  PubMed Central  Google Scholar  * McCormick, C. &

Khaperskyy, D. A. Translation inhibition and stress granules in the antiviral immune response. _Nat. Rev. Immunol._ 17, 647–660 (2017). Article  CAS  PubMed  Google Scholar  * Onomoto, K. et

al. Critical role of an antiviral stress granule containing RIG-I and PKR in viral detection and innate immunity. _PLoS ONE_ 7, e43031 (2012). Article  CAS  PubMed  PubMed Central  Google

Scholar  * Hou, S. et al. Zika virus hijacks stress granule proteins and modulates the host stress response. _J. Virol._ 91, e00474–17 (2017). Article  CAS  PubMed  PubMed Central  Google

Scholar  * Rabouw, H. H. et al. Middle east respiratory coronavirus accessory protein 4a inhibits PKR-mediated antiviral stress responses. _PLoS Pathog._ 12, e1005982 (2016). Article  PubMed

  PubMed Central  CAS  Google Scholar  * Nakagawa, K., Narayanan, K., Wada, M. & Makino, S. Inhibition of stress granule formation by middle east respiratory syndrome coronavirus 4a

accessory protein facilitates viral translation, leading to efficient virus replication. _J. Virol._ 92, e00902–18 (2018). Article  CAS  PubMed  PubMed Central  Google Scholar  * Hu, Z. et

al. Inclusion bodies of human parainfluenza virus type 3 inhibit antiviral stress granule formation by shielding viral RNAs. _PLoS Pathog._ 14, e1006948 (2018). Article  PubMed  PubMed

Central  CAS  Google Scholar  * Taefehshokr, N., Taefehshokr, S., Hemmat, N. & Heit, B. Covid-19: perspectives on innate immune evasion. _Front. Immunol._ 11, 580641 (2020). Article  CAS

  PubMed  PubMed Central  Google Scholar  * Alarifi, S., Ali, D., Alkahtani, S., Siddiqui, M. A. & Ali, B. A. Arsenic trioxide-mediated oxidative stress and genotoxicity in human

hepatocellular carcinoma cells. _Oncotargets Ther._ 6, 75–84 (2013). CAS  Google Scholar  * Clemens, M. J. & Elia, A. The double-stranded RNA-dependent protein kinase PKR: structure and

function. _J. Interferon Cytokine Res._ 17, 503–524 (1997). Article  CAS  PubMed  Google Scholar  * Dey, M. et al. Mechanistic link between PKR dimerization, autophosphorylation, and

eIF2alpha substrate recognition. _Cell_ 122, 901–913 (2005). Article  CAS  PubMed  Google Scholar  * Ruggieri, A. et al. Dynamic oscillation of translation and stress granule formation mark

the cellular response to virus infection. _Cell Host Microbe_ 12, 71–85 (2012). Article  CAS  PubMed  Google Scholar  * Garcia, M. A., Meurs, E. F. & Esteban, M. The dsRNA protein kinase

PKR: virus and cell control. _Biochimie_ 89, 799–811 (2007). Article  CAS  PubMed  Google Scholar  * Lu, L., Han, A. P. & Chen, J. J. Translation initiation control by heme-regulated

eukaryotic initiation factor 2alpha kinase in erythroid cells under cytoplasmic stresses. _Mol. Cell Biol._ 21, 7971–7980 (2001). Article  CAS  PubMed  PubMed Central  Google Scholar  * Li,

J. et al. Virus-host interactome and proteomic survey reveal potential virulence factors influencing SARS-CoV-2 pathogenesis. _Med._ 2, 99–112 (2020). Article  PubMed  Google Scholar  *

Gordon, D. E. et al. A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. _Nature_ 583, 459–468 (2020). Article  CAS  PubMed  PubMed Central  Google Scholar  * Surjit,

M. & Lal, S. K. The SARS-CoV nucleocapsid protein: a protein with multifarious activities. _Infect. Genet Evol._ 8, 397–405 (2008). Article  CAS  PubMed  Google Scholar  * Yang, X. et

al. Picornavirus 2A protease regulates stress granule formation to facilitate viral translation. _PLoS Pathog._ 14, e1006901 (2018). Article  PubMed  PubMed Central  CAS  Google Scholar  *

Zhang, Q., Sharma, N. R., Zheng, Z. M. & Chen, M. Viral regulation of RNA granules in infected cells. _Virol. Sin._ 34, 175–191 (2019). Article  CAS  PubMed  PubMed Central  Google

Scholar  * Toroney, R., Nallagatla, S. R., Boyer, J. A., Cameron, C. E. & Bevilacqua, P. C. Regulation of PKR by HCV IRES RNA: importance of domain II and NS5A. _J. Mol. Biol._ 400,

393–412 (2010). Article  CAS  PubMed  PubMed Central  Google Scholar  * Tu, Y. C. et al. Blocking double-stranded RNA-activated protein kinase PKR by Japanese encephalitis virus

nonstructural protein 2A. _J. Virol._ 86, 10347–10358 (2012). Article  CAS  PubMed  PubMed Central  Google Scholar  * Takeuchi, K., Komatsu, T., Kitagawa, Y., Sada, K. & Gotoh, B. Sendai

virus C protein plays a role in restricting PKR activation by limiting the generation of intracellular double-stranded RNA. _J. Virol._ 82, 10102–10110 (2008). Article  CAS  PubMed  PubMed

Central  Google Scholar  * Zhang, Y. et al. Enterovirus 71 inhibits cytoplasmic stress granule formation during the late stage of infection. _Virus Res._ 255, 55–67 (2018). Article  CAS 

PubMed  Google Scholar  * White, J. P., Cardenas, A. M., Marissen, W. E. & Lloyd, R. E. Inhibition of cytoplasmic mRNA stress granule formation by a viral proteinase. _Cell Host Microbe_

2, 295–305 (2007). Article  CAS  PubMed  Google Scholar  * Ng, C. S. et al. Encephalomyocarditis virus disrupts stress granules, the critical platform for triggering antiviral innate immune

responses. _J. Virol._ 87, 9511–9522 (2013). Article  CAS  PubMed  PubMed Central  Google Scholar  * Ye, X. et al. Foot-and-mouth disease virus counteracts on internal ribosome entry site

suppression by G3BP1 and inhibits G3BP1-mediated stress granule assembly via post-translational mechanisms. _Front. Immunol._ 9, 1142 (2018). Article  PubMed  PubMed Central  CAS  Google

Scholar  * Humoud, M. N. et al. Feline calicivirus infection disrupts assembly of cytoplasmic stress granules and induces G3BP1 cleavage. _J. Virol._ 90, 6489–6501 (2016). Article  CAS 

PubMed  PubMed Central  Google Scholar  * Vattem, K. M., Staschke, K. A. & Wek, R. C. Mechanism of activation of the double-stranded-RNA-dependent protein kinase, PKR: role of

dimerization and cellular localization in the stimulation of PKR phosphorylation of eukaryotic initiation factor-2 (eIF2). _Eur. J. Biochem._ 268, 3674–3684 (2001). Article  CAS  PubMed 

Google Scholar  * Bou-Nader, C., Gordon, J. M., Henderson, F. E. & Zhang, J. The search for a PKR code-differential regulation of protein kinase R activity by diverse RNA and protein

regulators. _RNA_ 25, 539–556 (2019). Article  CAS  PubMed  PubMed Central  Google Scholar  * Dey, M., Mann, B. R., Anshu, A. & Amin-ul Mannan, M. Activation of protein kinase PKR

requires dimerization-induced cis-phosphorylation within the activation loop. _J. Biol. Chem._ 289, 5747–5757 (2014). Article  CAS  PubMed  Google Scholar  * Dey, M., Cao, C., Sicheri, F.

& Dever, T. E. Conserved intermolecular salt bridge required for activation of protein kinases PKR, GCN2, and PERK. _J. Biol. Chem._ 282, 6653–6660 (2007). Article  CAS  PubMed  Google

Scholar  * Ung, T. L., Cao, C., Lu, J., Ozato, K. & Dever, T. E. Heterologous dimerization domains functionally substitute for the double-stranded RNA binding domains of the kinase PKR.

_EMBO J._ 20, 3728–3737 (2001). Article  CAS  PubMed  PubMed Central  Google Scholar  * Jiang, R. D. et al. Pathogenesis of SARS-CoV-2 in transgenic mice expressing human

angiotensin-converting enzyme 2. _Cell_ 182, 50–58.e8 (2020). Article  CAS  PubMed  PubMed Central  Google Scholar  * Wang, M. et al. Remdesivir and chloroquine effectively inhibit the

recently emerged novel coronavirus (2019-nCoV) in vitro. _Cell Res._ 30, 269–271 (2020). Article  CAS  PubMed  PubMed Central  Google Scholar  * Weber, M. & Weber, F. Monitoring

activation of the antiviral pattern recognition receptors RIG-I and PKR by limited protease digestion and native PAGE. _J. Vis. Exp._ 89, e51415 (2014). Google Scholar  * Robert, X. &

Gouet, P. Deciphering key features in protein structures with the new ENDscript server. _Nucleic Acids Res._ 42, W320–W324 (2014). Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references ACKNOWLEDGEMENTS We thank Dr. Ding Gao of the Core Facility and Technical Support of Wuhan Institute of Virology for help with confocal microscopy. This study was

supported by the National Key R&D Program of China (2020YFC0841000), the Strategic Priority Research Program of Chinese Academy of Sciences (XDB29010302), the National Natural Science

Foundation of China (31800732), the Key Research Programs of Frontier Sciences funded by the Chinese Academy of Sciences, and the Distinguished Research Assistant Program funded by the

Chinese Academy of Sciences. AUTHOR INFORMATION Author notes * These authors contributed equally: Zhou-Qin Zheng, Su-Yun Wang, Zhi-Sheng Xu AUTHORS AND AFFILIATIONS * Key Laboratory of

Special Pathogens and Biosafety, Wuhan Institute of Virology, Center for Biosafety Mega-Science, Chinese Academy of Sciences, Wuhan, Hubei, China Zhou-Qin Zheng, Su-Yun Wang, Zhi-Sheng Xu, 

Yu-Zhi Fu & Yan-Yi Wang * University of Chinese Academy of Sciences, Beijing, China Zhou-Qin Zheng & Yan-Yi Wang Authors * Zhou-Qin Zheng View author publications You can also search

for this author inPubMed Google Scholar * Su-Yun Wang View author publications You can also search for this author inPubMed Google Scholar * Zhi-Sheng Xu View author publications You can

also search for this author inPubMed Google Scholar * Yu-Zhi Fu View author publications You can also search for this author inPubMed Google Scholar * Yan-Yi Wang View author publications

You can also search for this author inPubMed Google Scholar CONTRIBUTIONS Z-Q.Z., Y-Z.F., and Y-Y.W. conceived, designed, and supervised the study and wrote the manuscript. Z-Q.Z., Y-Z.F.,

and S-Y.W. performed data analysis. S-Y.W. and Z-S.X. performed SARS-CoV-2-related experiments in BSL-3 laboratory of Wuhan Institute of Virology. All authors read and approved the contents

of the manuscript. CORRESPONDING AUTHORS Correspondence to Yu-Zhi Fu or Yan-Yi Wang. ETHICS DECLARATIONS CONFLICT OF INTEREST The authors declare no competing interests. ADDITIONAL

INFORMATION PUBLISHER’S NOTE Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. RIGHTS AND PERMISSIONS OPEN ACCESS This

article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as

you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party

material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s

Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.

To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Zheng, ZQ., Wang, SY., Xu, ZS. _et al._

SARS-CoV-2 nucleocapsid protein impairs stress granule formation to promote viral replication. _Cell Discov_ 7, 38 (2021). https://doi.org/10.1038/s41421-021-00275-0 Download citation *

Received: 07 December 2020 * Accepted: 12 April 2021 * Published: 25 May 2021 * DOI: https://doi.org/10.1038/s41421-021-00275-0 SHARE THIS ARTICLE Anyone you share the following link with

will be able to read this content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt

content-sharing initiative