ABSTRACT Neuronal excitotoxicity induced by aberrant excitation of glutamatergic receptors contributes to brain damage in stroke. Here we show that tau-deficient (tau−/−) mice are profoundly

protected from excitotoxic brain damage and neurological deficits following experimental stroke, using a middle cerebral artery occlusion with reperfusion model. Mechanistically, we show

that this protection is due to site-specific inhibition of glutamate-induced and Ras/ERK-mediated toxicity by accumulation of Ras-inhibiting SynGAP1, which resides in a post-synaptic complex

with tau. Accordingly, reducing SynGAP1 levels in tau−/− mice abolished the protection from pharmacologically induced excitotoxicity and middle cerebral artery occlusion-induced brain

Article 10 August 2020 MOLECULAR MECHANISMS OF EXCITOTOXICITY AND THEIR RELEVANCE TO THE PATHOGENESIS OF NEURODEGENERATIVE DISEASES—AN UPDATE Article Open access 19 May 2025 KCTD13-MEDIATED

UBIQUITINATION AND DEGRADATION OF GLUN1 REGULATES EXCITATORY SYNAPTIC TRANSMISSION AND SEIZURE SUSCEPTIBILITY Article 04 May 2023 INTRODUCTION Stroke remains a major cause of disability and

the second most common cause of death after cardiovascular conditions1. Ischemic strokes with acute focal brain infarction together with sudden and persisting neurological deficits are the

most prevalent form. While neurons within the ischemic core region are likely to be irreversibly damaged, neurons in surrounding brain areas (referred to as the penumbra) are at risk of

undergoing progressive necrotic/apoptotic death following the initial infarct2. There is only a short window for therapeutic intervention, aiming primarily at restoring blood flow to the

ischemic brain areas either by pharmacological or mechanical thrombolysis before neurons are irreversibly damaged3,4,5,6. However, the reperfusion itself may cause harm to neurons2. The

mechanisms leading to neuronal damage following ischemia and reperfusion are multifaceted, including production of reactive oxygen species (ROS), mitochondrial failure and others7. A major

contributor to neuronal damage in stroke is excitotoxicity8, which results from over-excitation of glutaminergic synapses, particularly NMDA receptor (NMDAR) signaling9. However, many of its

molecular pathways are yet to be identified. The microtubule-associated protein tau is abundant in neurons, regulating stability and dynamics of microtubules10. It is the major constituent

of neurofibrillary tangles in Alzheimer’s disease (AD) and frontotemporal dementia (FTD)11. Tau is progressively hyperphosphorylated in disease, which makes it prone to

aggregation/deposition and interferes with its normal cellular functions10, 12. AD/FTD-like tau pathology has been reproduced in many mouse models by overexpressing tau, but interestingly

tau−/− mice are phenotypically normal throughout development and adolescence, and may present deficits only at advanced ages13. Bearing similarities to early changes in AD, experimental

animal models of stroke revealed changes in phosphorylation of tau, with reduction during early reperfusion after ischemia, followed by persisting hyperphosphorylation hours after the

initial infarct14,15,16,17,18,19. Whether this reflects a general stress-response of neurons, or if tau plays a mechanistic role in stroke, however, remains unclear. We and others have shown

that memory deficits and early deaths in AD mice are tau-dependent20,21,22. Reducing tau in AD mouse models prevented excitotoxicity-mediated deficits, and tau-deficient mice showed

protection from excitotoxic seizures20, 21. Given the role of excitotoxicity in stroke23,24,25, we hypothesize that reduction of tau would reduce acute excitotoxic brain damage in stroke,

which in turn would reveal a mechanistic role of tau in stroke. To test this hypothesis in vivo, we used tau-deficient mice together with models of experimental stroke and excitotoxicity.

This approach revealed a profound protection from acute excitotoxic brain damage in the absence of tau, which is mediated, at least in parts, by site-specific inhibition of extracellular

signal-regulated kinase (ERK) signaling. RESULTS TAU−/− MICE ARE PROTECTED FROM SEVERE DEFICITS AFTER STROKE To determine if tau contributes to brain damage following stroke, we subjected

wild-type (tau+/+) and tau−/− mice (Fig. 1a) to transient middle cerebral artery occlusion (MCAO) with reperfusion of ischemic brain areas, an experimental paradigm replicating clinical

presentations of patients with successful recanalization or thrombolysis26, 27. We chose 90 min MCAO followed by reperfusion to produce infarcts28 with profound and progressive expansion of

brain damage over 24 h (h)29. Laser Doppler flowmetry confirmed MCAO and reperfusion (Fig. 1b). Neurological assessment after MCAO and recovery from anesthesia revealed comparable minor

motor deficits in both tau+/+ and tau−/− mice at reperfusion, indicating a similar degree of initial ischemic injury (Fig. 1c and Supplementary Fig. 1). Furthermore, blood parameters (pH,

electrolytes, pCO2, BEecf, HCO3, total CO2, Hct), body temperature, blood pressure, heart rate and O2 saturation were similar in tau+/+ and tau−/− mice before, during and 1 h after the

procedure (Supplementary Table 1). There were also no overt differences in the vascular anatomy of the brain between tau+/+ and tau−/− mice (Supplementary Fig. 2). Twenty four hours after

MCAO, tau+/+ mice developed profound neurological deficits (Fig. 1c), consistent with progressive brain damage. Strikingly, tau−/− mice did not develop further deficits within 24 h,

suggesting protection from progression of transient MCAO-induced deficits. Non-seizure epileptiform activity after focal cerebral ischemia has been reported in rodents30, 31. Therefore, we

performed 24 h electroencephalography (EEG) recording using electrodes placed during the MCAO procedure to determine alterations in neuronal circuit response. In both tau+/+ and tau−/− mice,

baseline EEG recordings were comparable; as was the drop in EEG activity within 1 h after MCAO (Fig. 1d), further suggesting a similar degree of initial injury upon MCAO. Consistent with

previous reports in rodents30, 31, tau+/+ mice experienced frequent epileptiform discharges from 6 h and throughout the 24 h recording period after MCAO (Fig. 1d, e). In contrast, tau−/−

showed only very rare epileptiform discharges after MCAO, not significantly different from sham-operated mice. Furthermore, interictal total amplitude and EEG power across the frequency

spectrum decreased progressively in tau+/+ mice, while tau−/− mice showed gradual recovery after initial suppression of amplitude and spectral power (Fig. 1f, g), indicating functional

protection of ipsilateral neuronal circuits. Taken together, EEG recording after transient MCAO revealed a similar level of initial depression of brain activity in tau−/− and tau+/+ mice,

but development of epileptiform activity consistent with hyperexcitation only occurred in tau+/+ mice. Confirming that neuronal excitability was not compromised in tau−/− brains per se, we

measured comparable Ca2+ responses in brain slices of tau+/+ and tau−/− mice expressing the GCaMP5G Ca2+ reporter in neurons challenged with 1 mM glutamate (Supplementary Fig. 3). Next, we

determined if the protections in tau−/− mice was reflected by differences in infarct size compared to tau+/+. As expected, 24 h after transient MCAO, tau+/+ brains showed pronounced infarcts

(Fig. 1h). In contrast, tau−/− brains had drastically smaller lesions compared to tau+/+ mice (Fig. 1i). Early loss of neuronal microtubule-associated protein 2 (MAP2) staining has been

reported after stroke32. Accordingly, MAP2 staining was profoundly and broadly reduced in the ischemic cortex of tau+/+ mice 3 h after transient MCAO, while a moderate reduction of MAP2

staining in tau−/− brains was confined to a small core area without changes in areas of the cortex that corresponded to those affected in tau+/+ mice (Supplementary Fig. 4). Tau−/− mice

observed for up to 5 days after transient MCAO did show progressive improvement of the mild neurological deficits with no increase in infarct volumes (Fig. 2a–c), suggesting persisting

protection. Taken together, reduced neurological deficits after 90 min of transient MCAO in tau−/− mice were associated with markedly smaller infarcts. The substantial brain damage and

profound functional deficits in tau+/+ mice after 90 min of MCAO did not allow following up tau+/+ mice for longer than 24 h. Therefore, we subjected an additional cohort of tau+/+ and

tau−/− mice to 30 min of MCAO allowing longer-term follow up experiments (Fig. 3a). Following this milder transient MCAO, tau−/− mice displayed significantly less severe neurological

deficits compared to tau+/+ mice receiving this treatment (Fig. 3b). Both improved their functional deficits over the following days, with tau−/− displaying no neurological deficits on day 4

after MCAO, while tau+/+ mice required 6 days to fully recover. Similarly, tau−/− mice lost significantly less body weight within 2 days after MCAO, and recovered the lost weight faster

than tau+/+ animals (Fig. 3c). Notably, tau+/+ did not fully recover the lost body weight within 2 weeks after 30 min of transient MCAO. Both, tau+/+ and tau−/− mice showed significantly

decreased performance on the accelerating Rota-Rod 2 days after the MCAO procedure, although tau−/− mice performed significantly better than tau+/+ mice (Fig. 3d). These deficits recovered

fully 4 and 6 days after MCAO in tau−/− and tau+/+ mice, respectively. As expected, the brain damage was substantially less in tau−/− than tau+/+ mice 14 days after 30 min of transient MCAO

(Fig. 3e, f). Hence, reduced neurological and functional deficits were less profound and recovery was faster in tau−/− than tau+/+ mice after 30 min of transient MCAO, and was associated

with markedly smaller infarcts. MITIGATION OF EXCITOTOXIC GENE RESPONSE IN TAU−/− MICE Neuronal hyperexcitation results in expression of immediate-early genes (IEGs), including Arc33, cFos

and Junb34. Accordingly, Arc, cFos and Junb mRNA levels were 5.3 ± 1.4-fold, 5.4 ± 1.9-fold, and 4.0 ± 0.7-fold (p < 0.001; _N_ = 6) higher in the ipsilateral hemisphere of tau+/+ brains

1 h after transient MCAO (Fig. 4a). In contrast, induction of IEG transcription was blunted in the corresponding brain region in tau−/− mice (Fig. 4a). Consistent with differential Arc mRNA

regulation, increased staining for neuronal Arc protein in tau+/+, but not tau−/− brains was observed 3 h after transient MCAO (Supplementary Fig. 5a). Furthermore, phosphorylated (p) H2AX

staining, indicating cell damage with DNA breaks35, was restricted to the ischemic core in tau−/− brains, while being widely detectable in tau+/+ brains 3 h after MCAO (Supplementary Fig. 

5b). Hence, absence of a pronounced IEG expression and cell damage during the initial phase following MCAO, suggest protection of tau−/− neurons from early toxic signaling events after

re-perfusion. Using the PTZ model allowed us to isolate excitotoxic processes under tightly controlled experimental conditions in tau+/+ and tau−/− mice, utilizing it as a screening model

before translating back into the more complex MCAO model. Similar to our findings following transient MCAO, excitotoxicity-associated IEGs mRNA levels of Arc, cFos and Junb were markedly

increased in tau+/+, but not tau−/− mice in the PTZ-induced excitotoxic seizure model 0.5 and 1 h after administration (Fig. 4b). Using this experimental paradigm, we employed whole

transcriptome sequencing to determine if absence of excitotoxicity-associated IEGs in tau−/− mice reflects a general lack of response, or if only distinct genes are differentially regulated.

Global comparison of mRNA levels in brains 1 h after administration of PTZ showed clusters of both differentially and similarly regulated genes in tau+/+ and tau−/− mice (Fig. 4c,

Supplementary Fig. 6 and Supplementary Data 1 and 2). Quantitative PCR of selected genes independently confirmed this differential regulation upon PTZ administration (Fig. 4d), and shows a

similar profile of differentially regulated genes following MCAO of tau+/+ and tau−/− mice (Fig. 4e). Taken together, differential regulation of gene clusters suggests differential

activation of distinct signaling pathways in tau+/+ and tau−/− during excitotoxicity upon PTZ administration and MCAO. Given the prominent role of excitotoxicity in stroke8 and that tau−/−

mice show an increased latency to developing severe excitotoxic seizures induced by 50 mg/kg pentylenetetrazole (PTZ)20, 21, we focused our mechanistic investigation on the contribution of

excitotoxic signaling to brain damage. Focusing on excitotoxicity was further supported by larger brain damage after intra-cortical infusion of NMDA in tau+/+ compared to tau−/− mice (Fig. 

5a, b), and reduced NMDA-mediated neuronal death in tau−/− compared with tau+/+ primary cultured neurons (Fig. 5c, d). TAU−/− MICE LACK EXCITOTOXIC RAS/ERK ACTIVATION DAVID pathway analysis

indicated MAPK, p53, toll-like receptor, Wnt, melanogenesis, basal cell carcinoma and hedgehog signaling being differentially engaged upon PTZ-administration in tau+/+ and tau−/− mice (Fig. 

4f and Supplementary Table 2). Amongst these, MAPK signaling appeared to be most significantly affected in tau−/− mice (Fig. 4f), with the majority of differentially regulated target genes

being down-stream of ERK1/2 (Supplementary Table 2). Therefore, we next investigated ERK activation in tau+/+ and tau−/− brains after PTZ administration. In tau+/+ mice, PTZ induced

transient but pronounced ERK phosphorylation 10 min after administration that returned to baseline within 30 min (Fig. 6a, b). In contrast, virtually no increase in ERK phosphorylation

occurred in brains of PTZ-treated tau−/− mice. To directly assess NMDAR-mediated activation of ERK signaling, we treated primary neurons with NMDA (Fig. 6c, d). This resulted in increased

levels of ERK phosphorylation in tau+/+ neurons, but no activation and rather decreased phosphorylation of ERK in tau−/− cells. This is in line with a failure to activate ERK downstream of

synaptic NMDARs, while ERK inhibition mediated by extra-synaptic NMDARs36 remained intact in tau−/− neurons. Accordingly, treatment of primary neurons with bicuculline or KCl to increase

synaptic glutamate levels and induce excitotoxic signaling37, 38 resulted in ERK phosphorylation and IEGs induction in tau+/+ but not tau−/− cells (Fig. 6e–g). Significant ERK

phosphorylation upon receptor-independent activation with forskolin in tau+/+ and tau−/− neurons suggests that the ERK signaling cascade per se is functional, but at a reduced level in

tau−/− mice (Fig. 6e, f), indicating some form of inhibition. Taken together, tau−/− mice lack ERK activation upon excitotoxic stimulation. NMDARs activate ERK via the Ras/Raf/MEK signaling

pathway39. We have previously shown that tau-depletion compromises NMDAR downstream signaling21. Despite tau interacting with PSD-9521, 40, its role in down-stream excitotoxic signaling

remained to be shown. To identify the step of the Ras/Raf/MEK cascade in which tau regulates NMDAR-induced ERK activation, we first quantified excitotoxic Ras activation by Raf-mediated

pull-down of active, GTP-bound Ras. Surprisingly, no Ras activation occurred in tau−/− neurons after hyperexcitation compared to tau+/+ (Fig. 6h, i), despite indistinguishable total and

synaptic Ras levels (Fig. 6h and Supplementary Fig. 7), suggesting tau regulation of ERK activation is upstream of Ras. RasGRF, a guanine-nucleotide exchange factor that converts GDP-bound

Ras into its active GTP-bound state, has previously been shown to mediate Ras activation down-stream of NMDAR39, 41. In contrast, SynGAP1 is an endogenous inhibitor of Ras at the

post-synapse42, 43 that catalyzes GTP hydrolysis thereby inactivating Ras44. We first tested for changes in total and synaptic levels of RasGRF in tau−/−, but did not find any alterations

(Supplementary Fig. 7). Similarly, the interaction between RasGRF and NMDARs was unchanged in tau−/− compared to tau+/+ mice, and we found no evidence of an interaction between RasGRF and

tau that may have indicated a functional relevance possibly lost in tau−/− mice (Supplementary Fig. 7). In contrast, immunofluorescence staining revealed significantly stronger labeling of

SynGAP1 that co-localizes with post-synaptic PSD-95 in tau−/− compared to tau+/+ neurons, indicative of increased synaptic levels of SynGAP1 in tau−/− neurons (Fig. 6j, k). Since SynGAP1

resides at the post-synaptic density (PSD)42, 43, we next determined if the functional interaction between SynGAP1 and PSD-95 is altered in the absence of tau. To our surprise,

immunoprecipitation of SynGAP1 co-purified markedly more PSD-95 from tau−/− than tau+/+ brains (Fig. 6l, m), indicating that more SynGAP1 is bound to PSD-95 in the absence of tau. This

raised the question if tau has a direct regulating effect on post-synaptic SynGAP1. Therefore, we first assessed if tau and SynGAP1 reside together in a complex by co-immunoprecipitation.

Immunoprecipitation with 3 different tau antibodies co-precipitated SynGAP1 from tau+/+ brain extracts (Fig. 6n and Supplementary Fig. 7). Since co-immunoprecipitation from tissue lysates

does not provide spatial information, we next employed antibody-based fluorescence in situ proximity determination in primary tau+/+ neurons. Using tau- and SynGAP1-specific antibodies, we

found that tau and SynGAP1 reside in close proximity exclusively within dendritic spines of tau+/+ neurons (Fig. 6o). Finally, SynGAP1 co-immunoprecipitate with PSD-95 in the absence, but

not in the presence of co-expressed tau from transiently transfected cells (Fig. 6p), suggesting negative regulation of PSD-95/SynGAP1 complexes by tau. In summary, our data suggests a

post-synaptic accumulation of SynGAP1 in tau−/− mice, where it blocks Ras activation and therefore NMDAR-mediated ERK signaling. REDUCING SYNGAP1 RESTORES SUSCEPTIBILITY IN TAU−/− MICE If

increased post-synaptic accumulation of SynGAP1 in tau−/− neurons contributes to the protection from excitotoxicity, reducing SynGAP1 levels should render tau−/− neurons again susceptible to

excitotoxic damage and possibly brain damage after MCAO. Therefore, we designed short hairpin RNA (shRNA) for AAV-mediated targeted knockdown of SynGAP1 (AAV-SG1-shR) in neurons of tau−/−

mice. We administered AAV-SG1-shR or a control shRNA-expressing AAV (AAV-ctr-shR) by intracranial injections at postnatal day P1-3 in mice and showed significantly reduced levels of SynGAP1

in AAV-SG1-shR-injected, compared to AAV-ctr-shR-injected and naive mice at 2 months of age (Fig. 7a). Identification of transduced cells was determined by bicistronic expression of a GFP

reporter cassette downstream of the shRNA. Imaging showed the widespread distribution of GFP expression throughout the brain and reduction of SynGAP1 staining in transduced areas (Fig. 7b).

Hence, intracranial AAV-SG1-shR delivery efficiently reduced SynGAP1 levels in vivo. We then administered AAV-SG1-shR or AAV-ctr-shR in newborn tau−/− mice to determine the effects of

SynGAP1 reduction in vivo. First, we induced excitotoxic seizures by administering 50 mg/kg PTZ to 2 month-old tau−/− mice, which had received intracranial injections of either AAV-SG1-shR

or AAV-ctr-shR at P1-3. Both mean seizure severity and latency to developing seizures were comparable in AAV-ctr-shR-injected and naive tau−/− mice (Fig. 7c, d), suggesting no effects from

AAV-injection and shRNA expression per se. In contrast, AAV-SG1-shR injections increased the mean seizure severity of tau−/− mice significantly. While the latency was not significantly

reduced in AAV-SG1-shR-injected tau−/− mice, more mice developed severe bouncing seizures that were rarely seen in AAV-ctr-shR-injected or naive tau−/− mice within 10 min after PTZ

administration (Fig. 7d). In parallel to restoring sensitivity of tau−/− mice to PTZ-induced seizures by knocking down SynGAP1, Western blotting revealed that activation of ERK signaling in

response to PTZ administration was similar in tau−/− mice injected with AAV-SG1-shR and tau+/+ mice (Figs. 7e and 6a). In tau+/+ mice, there was a moderate trend to a reduced latency to

develop more severe seizures with more animals progressing to convulsive seizures when injected with AAV-SG1-shR compared with AAV-ctr-shR-injected controls (Supplementary Fig. 8).

Correspondingly, AAV-SG1-shR-injected tau+/+ mice showed a trend towards higher levels of ERK phosphorylation 10 min after PTZ compared to AAV-ctr-shR-injected controls (Supplementary Fig. 

8). Conversely, SynGAP1 over-expression in primary neurons mitigated NMDA-induced ERK phosphorylation (Fig. 8a, b). Finally, we performed transient 1.5 h MCAO with reperfusion in tau−/− mice

that were previously injected with AAV-SG1-shR or AAV-ctr-shR at P1-3 (Fig. 9a). AAV-ctr-shR-injected tau−/− mice showed the same minor neurological deficits (Fig. 9b) as naive tau−/− mice

after transient MCAO (Fig. 1c). In contrast, knockdown of SynGAP1 in tau−/− mice was associated with severe neurological deficits 24 h after MCAO (Fig. 9b), similar to tau+/+ mice (Fig. 1c).

The neurological deficits were paralleled by large MCAO-induced brain infarcts in AAV-SG1-shR-injected tau−/− mice after 24 h, while the infarct sizes in AAV-ctr-shR-injected tau−/− mice

remained small (Fig. 9c, d). Infarct sizes were comparable 24 h after transient MCAO in in AAV-SG1-shR-injected tau+/+ mice compared to AAV-ctr-shR-injected controls, and their neurological

deficits did not worsen any further, likely due to the already profound deficits of controls (Supplementary Fig. 8). Taken together, reducing neuronal SynGAP1 levels in tau−/− mice

re-established their sensitivity to excitotoxic injury and transient MCAO-induced deficits and brain damage, suggesting tau-mediated excitotoxicity involves control of post-synaptic SynGAP1.

DISCUSSION In the present study, we show that genetic depletion of tau prevents brain damage and neurological deficits after MCAO-induced stroke in mice. In parallel, tau−/− mice lack

pronounced excitotoxic IEG response and ERK activation. Mechanistically, we have shown that tau limits the binding of SynGAP1, a site-specific inhibitor of Ras, to the post-synaptic PSD-95

protein complex, enabling Ras-mediated ERK activation downstream of NMDARs (Fig. 10). Although the level of protection from brain damage after stroke in tau−/− mice is substantial, it is not

unprecedented; a similar ~90% reduction of brain damage after 90 min MCAO has for example been achieved when targeting the NMDAR/PSD-95 complex with interfering peptides24, 45 or blocking

ERK signaling46. Interestingly, the molecular target that conferred this substantial protection24 is within the same post-synaptic pathway complex we show in the present study in tau−/−

mice. Liu et al.29 showed that 90 min MCAO caused a small area of brain damage within 1 h after the procedure, that gradually increased in size involving a majority of the hemisphere 24 h

later, far beyond the terminal supply area of the MCA. For comparison, the brain damage in tau−/− mice 24 h after MCAO was of a size similar to that reported for wild-type mice directly

after MCAO26, 29. Importantly, the reduction in infarct size in tau−/− mice was despite similar initial functional deficits, reduction in EEG activity and physiological responses directly

following the procedure compared to tau+/+ littermates. Furthermore, neuronal excitability in tau−/− and tau+/+ mice indistinguishable. Our data suggests that tau significantly contributes

to progressive damage of at-risk brain areas, likely by regulating excitotoxic signaling. Differences in brain vasculature, however, are unlikely to underlie the protection from stroke in

tau−/− mice, since laser Doppler flowmetry showed the same reduction in cerebral blood flow during the MCAO procedure in tau+/+ and tau−/− mice, and reduction of SynGAP1 levels restored

susceptibility to brain damage after MCAO in tau−/− mice. The latter molecular intervention would not affect cerebral blood supply and would not have abolished the protection in tau−/− mice

if vascular differences conferred this protection. Others and we have previously reported that tau-deficient mice are protected from Aβ-induced deficits in AD mouse models, due to reduced

susceptibility to excitotoxic neuronal damage20, 21, 47. The protection of tau−/− (and to a lesser degree tau+/−) mice from excitotoxic brain damage received further support using either

pharmacological20, 21 or genetic epilepsy models48, as well as by direct intra-cortical NMDA infusion used in our study. Brain damage due to ischemia is orchestrated by a range of molecular

mechanisms, including excitotoxicity8. Using the PTZ model of a temporally controlled and synchronized excitotoxic response, allowed us to explore the distinct tau-dependent molecular

mechanisms. Interestingly, the cellular response to both the MCAO and PTZ paradigms were remarkably similar at the gene regulation level (Fig. 4). Furthermore, translating the molecular

mechanisms of tau-dependent SynGAP1 regulation at the post-synapse back into the MCAO model supported our approach. Differential mRNA expression in PTZ-treated tau−/− mice together with

pathway prediction suggested compromised MAPK signaling. Combining experiments in primary neurons and in vivo, we were able to show that tau is required to induce IEG response and mediate

cell damage via Ras/ERK signaling down-stream of NMDARs hyperexcitation. Supporting that a lack of Ras/ERK signaling in tau−/− mice after MCAO contributes to the protections, others and we

previously showed that inhibiting ERK activation with MEK1 inhibitors prevented IEG response, epileptogenesis and stroke-associated progressive brain damage46, 49, 50. Taken together,

Ras/ERK signaling is a major pathway in mediating excitotoxic brain damage, and is regulated down-stream of NMDARs by tau. The absence of Ras-GTP after stimulation of tau−/− neurons

indicated a role of tau in excitotoxic NMDAR signaling upstream of Ras. SynGAP1 is found exclusively at post-synaptic sites in neurons, where it interacts with PSD-95 and inhibits Ras

activity42, 43. The latter function of SynGAP1 is modulated by CaMKII-mediated and cdk5-mediated phosphorylation, which drives SynGAP1 out of post-synaptic densities, thereby possibly

preventing excessive NMDAR-mediated Ras activation43, 51,52,53,54 and regulating AMPA receptor trafficking55. SynGAP1 belongs to the Ras GTPase activating protein (RasGAP) family, which

inactivate Ras by catalyzing GTP hydrolysis, bringing Ras back into its inactive, GDP-bound state44. Surprisingly, but in line with absent Ras activation in tau−/− neurons, we found markedly

elevated levels of SynGAP1 at the post-synapse in complexes with PSD-95 in tau−/− brains. Transient cerebral ischemia in rats resulted in persisting (up to 24 h) phosphorylation of

SynGAP156, 57, promoting increased interaction with Fyn paralleled by decreased PSD-95/SynGAP1 interaction56. This may reduce SynGAP1-mediated inhibition of excitotoxic Ras activation and

therefore contribute to neuronal damage56. We have previously shown that synaptic Fyn levels are markedly reduced in tau−/− mice21, possibly exacerbating the Ras-inhibitory effect of

increased SynGAP1 levels during transient MCAO. Interestingly, pathogenic mutations in _SYNGAP1_ have been linked to mental retardation58 and distinct forms of epilepsy59, 60. Both,

pathogenic missense and truncation mutants of _SYNGAP1_ failed to reduce activity-dependent ERK phosphorylation when expressed in neurons, suggesting a loss-of-function mechanism60.

Similarly, ERK activation is increased in primary neurons obtained from SynGAP1−/− mice61 and by siRNA-mediated knockdown of SynGAP1 in primary wild-type neurons after NMDAR excitation62.

While homozygote SynGAP1-deficient mice die postnatally63, heterozygote SynGAP1-deficient mice are characterized by cognitive defects and spine maturation defects64,65,66,67. Importantly, we

showed that reducing SynGAP1 levels in tau−/− mice by AAV-mediated shRNA expression, reinstated their susceptibility to induced seizures and progressive neurological deficits with brain

damage following transient MCAO. The degree of seizures, neurological deficits and brain damage in AAV-SG1-shR-injected tau−/− mice following PTZ administration and MCAO were nearly as

prominent as in tau+/+ mice. This suggests that increased SynGAP1 levels at the post-synapse of tau−/− mice contribute significantly to their protection threshold, likely by providing a

constant and strong inhibition of Ras activation and therefore disrupting Ras/ERK pathway in excitotoxic NMDAR signaling. A number of studies reported changes in tau phosphorylation after

ischemia, focusing on long-term effects of pathologically phosphorylated tau (AD-like mechanisms) on memory14,15,16,17,18,19. Consistent with these prior studies, we showed increased tau

phosphorylation upon PTZ-induced excitotoxicity and MCAO in wild-type mice (Supplementary Fig. 9). However, our findings that reducing SynGAP1 levels and reinstating an excitotoxic ERK

response in tau−/− mice increased susceptibility to induced seizures and abolished the protection from MCAO-mediated brain damage despite the absence of tau, supports that tau

phosphorylation does not contribute significantly to the acute excitotoxic deficits. A mechanistic role of tau phosphorylation in particular in the long-term deficits following stroke

remains to be shown. In summary, we showed that tau−/− mice were protected from reperfusion damage induced by transient MCAO. In our study, we focused on tau-dependent excitotoxicity and

found reduced excitotoxic Ras/ERK activation down-stream of NMDARs together with a concomitant increase of Ras-inhibiting SynGAP1 at the post-synapse in tau−/− mice, suggesting

compartment-specific Ras inhibition. This suggests that tau controls post-synaptic SynGAP1 and therefore NMDAR-dependent Ras/ERK signaling in neurons. Our findings of virtually complete

protection of tau−/− mice from acute brain damage in stroke with reperfusion introduce a new role for tau in this context and indicate a critical physiological role for control of

post-synaptic compartmentalization of SynGAP1. Finally, our data suggest tau and SynGAP1 as potential drug targets in acute brain damage from stroke, therefore making targeting tau-dependent

processes relevant beyond progressive age-related neurodegenerative disorders, such as AD. METHODS MICE Tau−/− mice were generated by knockin of green fluorescence protein (GFP) encoding

cDNA into the first exon of the endogenous _Mapt_ locus as described before68 (available from JaxMice #004779). Mice were maintained on a C57Bl/6 background. Three to 6 months old male mice

were used throughout the study at indicated N-numbers. Experimenters were blinded to the randomly assigned genotype or type of AAV injected for all experiments until after analysis was

completed. Blinding and sample/animal randomization was done by staff not involved in the study. All procedures were approved by the Animal Ethics Committee of the University of Sydney and

the University of New South Wales, Australia. MIDDLE CEREBRAL ARTERY OCCLUSION Transient MCAO was used to induce stroke in adult mice69. Accordingly, male C57Bl/6 mice (age: 3–6 months; body

weight: 25–35 g) were anesthetized and placed on their backs to expose the neck area. The common (CCA), external (ECA) and internal carotid arteries (ICA) were exposed via a ventral midline

neck incision and connecting tissue around the vasculature was removed. The distal ECA was tied off and opened by arteriotomy and a heat-blunted 5-0 nylon monofilament was inserted and

gently advanced upwards, ~10 mm past the CCA bifurcation. Reduction in cerebral blood flow, as determined by transcranial laser Doppler flowmetry (Moor instruments), confirmed MCAO. The

monofilament was withdrawn after 1.5 h or 30 min (for long-term follow up) under continued anesthesia. Body temperature was maintained and monitored by placing mice on rectal

probe-controlled heat pads (Kent Scientific Corporation) for the duration of the entire procedures. Mice were individually housed after full recovery from anesthesia. Neurological severity

scoring (NSS) was done at indicated time points, according to the following (Supplementary Fig. 1): grade 0, no deficits; 1, decreased resistance to lateral push; 2, limb extension; 3, limb

elevation; 4, circling. Animals were terminated at indicated time points after onset of MCAO. Mice for long-term follow up (30 min MCAO) were weighed and neurologically scored daily. In sham

operated controls, the carotid arteries where exposed and the ECA cauterized before the skin was closed again. Mice that had bleeding complications during the surgery or when the filament

was removed were excluded from the study and not counted to the total numbers examined. This occurred in less than 10% of mice, and as frequently in tau−/− and tau+/+ mice. Blood pressure

was recorded from the tail with CODA Surgical Monitor. Heart rate, peripheral O2 saturation and body temperature were monitored using a PhysioSuite system (both Kent Scientific Corporation).

Blood gases and electrolytes from whole blood were analyzed with an i-STAT Handheld device and CG8 + cartridges (Abbott). ROTA-ROD TESTING Rota-Rod testing of mice that have undergone 30 

min of transient MCAO was performed as previously described70. Mice were trained on the accelerating-mode Rota-Rod (4–40 r.p.m. over 4 min) for 5 consecutive days prior to the surgery.

Testing was done every 2 days after MCAO. CORTICAL NMDA INFUSION Stereotaxic surgeries were done as previously described71. Briefly, mice were anaesthetized with isoflurane and mounted in a

stereotaxic frame (KOPF). The skin over the skull was opened and the bone exposed and cleaned. A small burr hole to allow injection into the brain was drilled into the skull. Coordinates for

cortical injections were: AP: −2 mm, RL: 1.2 mm, DV: 1 mm. NMDA (50 mM; 0.2 µl) was infused over 1 minute into the cortex of mice under isoflurane anesthesia. The needle was left in place

for another 5 min. After the surgery, mice were removed from the frame and the skin closed with sutures. All surgeries were done under aseptic conditions. Mice were transcardially perfused

24 h after the surgery, brains removed, paraffin embedded and serial sections stained with a standard Nissl protocol. The area damaged was determined on 10 serial 10 µm sections at 100 µm

intervals. ADENO-ASSOCIATED VIRUS VECTORS A KpnI-linkered DNA fragment, entailing the mouse U6 promoter and a SynGAP1 small hairpin (sh) RNA (ccagaaccctctcttccatat), was synthesized

(Epochbiolabs, Missouri City, USA) and cloned into a rAAV plasmid containing the CAG promoter driving a humanized renilla GFP reporter (Adeno-associated virus (AAV)-SG1-shR). The same

backbone with an EGFP shRNA replacing SynGAP1 served as a control (AAV-ctr-shR). Packaging of rAAV1 vectors was performed as described72. One µl of either AAV-SG1-shR or AAV-ctr-shR vector

(2 × 1012 viral genomes/ml) was injected bilaterally into the striatum ( + 4.0mm AP, ± 1.8 mm ML, −2.3 mm DV from lambda), thalamus ( + 2.0 mm AP, ± 1.7 mm ML, −2.5 mm DV) and cerebellum

(−2.3 mm AP, ± 2.0 mm ML, −2.8 mm DV) of cryo-anaesthetized neonatal mice as described73. ELECTROENCEPHALOGRAPHY Methodology of electroencephalography has been previously described74.

Briefly, after anesthesia with ketamine/xylazine and induction of MCAO, the recording electrode on remote telemetric transmitters (DSI) was implanted in the cornu ammonis (CA) region of the

hippocampus (−2.0 mm AP, + 2.0 mm ML, −2.0 mm DV from bregma) and the reference electrode placed above the cerebellum (−6.0 mm AP, 0 mm ML, 0 mm DV). Local field potentials (LFPs) were

recorded through amplifier matrices (DSI) at 500 Hz sampling rate (Dataquest A.R.T.). Raw LFPs were noise filtered using a powerline noise filter (DSI). Epileptiform discharge analysis of

EEG recordings was performed using NeuroScore software v3.0 (DSI) with integrated spike detection module. Fast Fourier transform-based spectral analysis of interictal sequences was performed

using NeuroScore software v3.0 (DSI). Average amplitude envelope time series were obtained by Hilbert transformation of filtered LFPs (MATLAB). PTZ ADMINISTRATION To induce excitotoxicity,

6 weeks-old mice were administered pentylenetetrazole (PTZ; 50 mg/kg bodyweight i.p.)21. Directly after the injection, mice were individually placed into a 40 × 40 cm box to observe the

development of seizures. Seizure severity rating was undertaken by an independent, blinded person as follows: 0, no seizures; 1, immobility; 2, tail extension; 3, forelimb clonus; 4,

generalized clonus; 5, bouncing seizures; 6, full body extension; 7, status epilepticus. PRIMARY NEURONAL CULTURES AND STAINING Primary neurons were obtained from 16 days-old tau+/+ and

tau−/− embryos75. Briefly, the abdominal cavity of time-mated females was opened to remove the uterus. Embryos were placed on ice, decapitated and brains removed. After meninges were

carefully removed, cortices and hippocampi were dissected and incubated with trypsin (Sigma) at 37 °C for 15–20 min, followed by trituration with fire-polished glass Pasteur pipettes

(Livingstone) to obtain single cell solutions. Cells were counted using a hemocytometer and plated in Dulbecco’s Modified Eagle Medium (Life technologies) medium containing 10%

heat-inactivated fetal bovine serum (Hyclone). Medium was changed to Neurobasal containing B27 supplement and Glutamax (all Life technologies) for continued culturing. Neurons were cultured

for 15 days, and then treated with either 10 µM NMDA, 25 µM NMDA, 50 mM KCl, 5 µM forskolin or 50 µM bicuculline for 30 min before harvesting for Western blotting. To determine cell death,

cells were treated with 0, 10 or 25 µM NMDA for 30 min. Then, NMDA-containing medium was removed and cells were washed twice with warm Neurobasal medium (Thermo) before conditioned medium

from before treatments was added back. After a further 24 h incubation, cells were fixed with 4% PFA and mounted in Fluoromount-G (SouthernBiotech) with DAPI (Molecular Probes). Cells with

condensed nuclei were considered dead76. For staining, cells were fixed at 21 days in vitro (DIV) with 4% PFA and stained with primary antibodies to SynGAP1 (Sigma) and PSD-95 (Millipore)

using established protocols77. Images were taken with an Eclipse Ti confocal microscope (Nikon). DIV 4 primary neurons were transfected V5 tagged SynGAP1 (V5-SynGAP1) or mCherry control pLVX

expression plasmids using Lipofectamine LTX (Invitrogen) according to the manufacturers protocol. DIV 12 neurons were pre-treated with 5 µM nifedipine, 40 µM CNQX and 1 µM tetrodotoxin

citrate (all from Tocris) for 1 h, followed by treatment with 100 µM NMDA (or vehicle) for 6 min at 37 °C/5% CO2. Primary antibodies for staining were against phosphorylated ERK (Cell

Signaling) and V5 (Sigma), and DAPI was used for nuclear visualization. Phosphorylated ERK staining intensity of randomly selected transfected neurons was quantified using ImageJ (NIH). Data

from vehicle treated cells were pooled, since there was no difference between transfections. CALCIUM IMAGING Mice were injected at P0 with AAVs expressing the Ca2+ reporter GCaMP5G. At 1

month of age, acute brain slices (400 μm) were prepared using VT1200 vibratome (Leica) according to standard procedures. Briefly, mice were sacrificed, brains removed and sectioned coronally

in modified high sucrose low sodium ice cold artificial cerebrospinal fluid (sACSF) containing 4 mM KCl, 1 mM CaCl2, 6 mM MgCl2, 25 mM NaHCO3, 246 mM sucrose, 10 mM glucose and the pH

indicator phenol red (pH adjusted to 7.3), bubbled with carbogen (95% O2, 5% CO2). Slices were thereafter maintained at room temperature in artificial cerebral spinal fluid (ACSF) solution

containing 119 mM NaCl, 2.5 mM KCl, 2.5 mM CaCl2, 1.5 mM MgCl2, 26 mM NaHCO3, 1 mM NaH2HPO4, and 11 mM glucose, bubbled with carbogen. After equilibration of at least 60 min, slices were

transferred onto a recording chamber and constantly superfused at 2 ml/min ACSF bubbled with carbogen. After recording baseline responses for 5 min, slices were exposed to 1 mM glutamate

(bath applied in ACSF) for 5 min and cortical Ca2+ responses were monitored until neurons recovered back to baseline levels. Changes in GCaMP5G fluorescence in the cortex were imaged using a

confocal microscope (Zeiss 710NLO LSM, 488 nm excitation; 5x/0.3 W objective). Images were taken every 10 seconds. The Zen software (Zeiss) was used to measure mean pixel intensity of the

whole field. HISTOLOGY Immunohistochemical staining and quantification of fluorescence intensity has been previously described in detail78. Briefly, paraformaldehyde fixed and paraffin

embedded tissue was section on a microtome (Thermo) to 5 µm. Sections were rehydrated via xylene followed by decreasing concentrations of ethanol. For staining, sections were individually

mounted in Sequenza racks (Thermo), blocked with 2% heat-inactivated goat serum (Sigma)/3% bovine serum albumin (Sigma) in PBS, before incubation with primary antibodies. Primary antibodies

were visualized by incubation with Alexa-fluorophore labeled secondary antibodies (1:250, Molecular Probes) after washing with PBS. Primary antibodies were against SynGAP1 (1:100, Sigma),

MAP2 (1:500, Sigma), Arc (1:100, SantaCruz), pH2AX (1:200, Chemicon), NeuN (1:500, Chemicon), hrGFP (1:250, abcam) and Tau5 (1:250, Invitrogen). DAPI (Molecular Probes) was used for nuclear

counterstaining. 1mm fresh brain slices were obtained with a brain blocker (KOPF) and stained for 10 min at 37 °C with a 2% TTC/PBS (Sigma) solution until viable tissue turned bright red.

Fluorescence intensity and infarct size were determined using ImageJ (NIH). Infarct sizes were adjusted for cerebral edema using the contralateral hemisphere as control. CEREBRAL VASCULATURE

VISUALIZATION Cerebral vasculature staining was performed using Indian ink gelatin solution79. Briefly, deeply anesthetized mice were perfused with PBS and cold 4% PFA via left ventricular

puncture followed by slow infusion of 0.5–1 ml 50% Indian ink in 5% gelatin at a rate of 1 ml per 30 s. Perfusion was stopped prior to ink returning to the right atrium to reduce cerebral

venous filling. Mice were then left to chill on ice for 10 min to allow the gelatin to set prior to careful removal of the brain. WESTERN BLOTTING For Western blotting, protein extracts were

separated by SDS-PAGE followed by semi-dry transfer onto 0.2 µm nitrocellulose membranes (Invitrogen)77. Membranes were blocked with 5% bovine serum albumin (Sigma) in TBS, washed with TBS

containing 1% Tween-80 (Sigma) and then incubated with primary antibodies in blocking buffer. Primary antibodies were against ERK (1:1000, Sigma), SynGAP1 (1:1000, Sigma), phospho-ERK

(1:500, Cell Signaling), V5 (1:5000, Invitrogen), Tau5 (1:1000, Invitrogen), pS214 (1:1000, Invitrogen), pS422 (1:2000, Invitrogen), pS396/pS404 (1:1000, PHF-1, P. Davies), RAS (1:1000,

Millipore), Psd95 (1:2000, Millipore) and Gapdh (1:5000, Millipore). Blots were visualized by HRP-coupled secondary antibodies (1:5000, Sigma), with Luminata Crescendo Western HRP substrate

(Millipore), and detected and quantified in a VersaDoc Model 4000 CCD camera (BioRad) or a ChemiDoc MP system (BioRad). Membranes were stripped for re-probing as previously described77. Full

membranes of all Western blots presented are provided in the Supplementary Fig. 10. RNA PURIFICATION AND QUANTITATIVE PCR A RNeasy Mini Kit (Qiagen) was used to extract total RNA from mouse

brain tissue and primary cultured neurons, following the manufacturer’s instructions. To remove contaminating genomic DNA, an on-column DNA-digest was performed with RNase-free DNase I

(Qiagen). cDNA was synthesized from 2.5 μg of total RNA with the second strand cDNA-synthesis kit (Invitrogen). mRNA levels were determined by quantitative PCR, using a Fast SYBR green

reaction mix (Invitrogen) and gene-specific primer pairs as listed in Supplementary Table 3, using a Mx3000 real-time PCR cycler (Stratagene). TRANSCRIPTOME AND PATHWAY ANALYSIS Next

generation RNA sequencing (RNA-Seq) was done by BGI-Hong Kong (China) using RNA extracted from vehicle-injected tau+/+ and tau−/− and PTZ-injected tau+/+ and tau−/− mice. PTZ mice with

similar seizure score were selected for this analysis. Briefly, at least 24 million, 90 bp long read pairs per sample could be aligned unambiguously to the GRCm38/mm10 version of the mouse

genome using tophat 2.0380 and bowtie 2.0.0.681 and allowing for 2 read mis-matches. Differential expression analysis was performed using Cuffdiff 2.0180 and only genes with a _p_-value of

less than 0.05 and a fold change of more than 1.5-fold were labeled as significantly differentially expressed. Genes were labeled as lack of response, if genes were significantly

differentially expressed in vehicle-injected compared to PTZ-injected tau+/+ mice and lacking or having a significantly milder response in the same direction in vehicle-injected compared to

PTZ-injected tau−/− mice. Functional annotation of the significant RNA-Seq genes was performed using DAVID82. KEGG pathway83 representations were used to represent the outcome of the

analysis. All sequencing data have been submitted to the GEO repository and are available under accession number GSE45703. ACTIVE RAS PULL-DOWN GTP-bound Ras was precipitated from stimulated

hippocampal slices as previously described84. Briefly, 2-month-old mice were sacrificed, brains removed and transferred into CO2-adjusted and ice-cold sucrose cutting solution (0.2 mM

CaCl2, 7 mM MgCl2, 28 mM NaHCO3, 11 mM glucose, 1.25 mM NaH2PO4, 2.5 mM KCl and 241 mM sucrose). The hippocampi were removed, sliced and then incubated in CO2-adjusted artificial cerebral

spinal fluid (aCSF) (127 mM NaCl, 2.5 mM KCl, 1.25 mM NaH2PO4, 1 mM MgCl2, 25 mM NaHCO3 and 25 mM glucose) for 30 min at 37 °C. Slices were stimulated at room temperature for 10 min in

modified aCSF containing 62.5 mM KCl, 4 mM CaCl2, no MgCl2, 10 μM CNQX, 5 μM d-AP, and 1 μM TTX. Reactions were terminated by replacing the medium with ice-cold lysis buffer (25 mM HEPES (pH

7.5), 150 mM NaCl, 1 % nonidet P-40, 0.25 % Na+-deoxycholate, 10 % glycerol, 10 mM MgCl2, 1 mM EDTA and protease inhibitor (Roche)). Lysates (100 μg) were incubated with recombinant Raf-RBD

coupled to beads to precipitate activate Ras. CO-IMMUNOPRECIPITATION Interaction of proteins was determined by co-immunoprecipitation experiments21. Briefly, brain tissue or cells were

homogenized in a buffer containing 50 mM Tris-HCl, 150 mM NaCl, 1% NP-40 (all Sigma) and complete proteinase inhibitor (Roche). After clearing by centrifugation, 200 µg of protein was

incubated with antibodies over night at 4 °C. Antibodies used for precipitation were against SynGAP1 (1:200, Sigma), Tau1 (1:200, Millipore), Tau5 (1:200, Invitrogen), RasGRF (1:200,

SantaCruz) and 4RTau (1:200, Dako). Antibodies were then captured with magnetic protein G beats (Invitrogen) and washed with lysis buffer and increasing NaCl concentrations (150-250-450 mM)

before adding sample buffer for subsequent Western blotting. HEK293T cells (ATCC) were transiently transfected with Flag-PSD-95, tau and V5-SynGAP1 expression plasmids as previously

described22. SYNAPTOSOME PREPARATIONS Synaptosomes were purified from mouse brains using a differential extraction procedure21; First, tissue was homogenized on ice in a Sucrose Buffer

containing 0.32 M sucrose, 1 mM NaHCO3, 1 mM MgCl2 and 0.5 mM CaCl2. Then, homogenates were cleared by two rounds of centrifugation (1400 × _g_/10 min/4 °C). The supernatants from both spins

were combined, cleared again by centrifugation (720 × _g_/10 min/4 °C), and then crude synaptosomes were pelleted by high-speed centrifugation (13,800 × _g_/10 min/4 °C). Pellets were

resuspended in 300 µl Sucrose Buffer, layered on top of 1 ml pre-cooled 5% Ficoll and high-speed centrifuged (45,000 × _g_/45 min/4 °C). Supernatant were discarded, pellets resuspended in

100 µl pre-cooled 5% Ficoll, and layered on top of 1 ml pre-cooled 13% Ficoll for the next high-speed centrifugation (45,000 × _g_/45 min/4 °C). The resulting interface contained the

purified synaptosomes, and was recovered carefully. Purified synaptosomes were extracted from the interfaces by diluting them with Sucrose Buffer followed by pelleting with high-speed

centrifugation (45,000xg/45 min/4 C). Pure synaptosomes were further fractionated to obtain soluble, membranous and PSD-associated proteins; Therefore, pellets were resuspended in 40 mM

Tris-HCl (pH 6) containing 2% Triton X-100, 0.5 mM CaCl2 (all Sigma) and complete protease inhibitors (Roche), followed by incubation (15 min/4 °C) and high-speed centrifugation (40,000 × 

_g_/30 min/4 °C). The supernatants were recovered as soluble protein fraction. Pellets were washed, using the same 40 mM Tris-HCl buffer, incubation and centrifugation conditions as in the

prior step. Then, the pellets were resuspended in 20 mM Tris-HCl (pH 8) containing 100 mM NaCl, 1 mM EGTA, 1 mM EDTA, 0.5% sodiumdeoxycholate, 0.1% SDS, 1% Triton X-100 (all Sigma) and

complete protease inhibitors, followed by incubation (15 min/4 °C) and high-speed centrifugation (40,000 × _g_/30 min/4 °C). The supernatants were recovered as membranous protein fraction.

Again, pellets were washed using the conditions of the prior step. The final extraction was done by resuspending the pellets in 5% SDS, sonication and high-speed centrifugation (20,000 × 

_g_/10 min/4 °C). The final supernatants resembled the PSD-associated protein fraction. DUOLINK PROXIMITY LIGATION ASSAY Primary neurons were fixed at 21 DIV with 4% PFA for 20 min and

permeabilized with 0.1% Triton X-100 in PBS for 5 min. Cells were incubated in Duolink blocking solution (Olink Bioscience) for 30 min at 37 °C, followed by incubation with monoclonal mouse

Tau5 (Invitrogen), rabbit SynGAP1 (Sigma) and chicken β3-tubulin (Chemicon) primary antibodies diluted in Duolink Antibody Diluent at for 1 h room temperature. The ligation assay was then

conducted according to the manufacturer’s instructions (Olink Bioscience) and β3-tubulin was detected using A488-labeled anti-chicken secondary antibody (Molecular Probes). Images were taken

with an Eclipse Ti confocal system (Nikon). STATISTICS Pre-study sample size calculation was based on decreased susceptibility of tau−/− mice to induced excitotoxic seizures, previously

shown by us21. To detect a 40% reduction in infarct size (_σ_ = 0.2) with a power of 0.95 and _α_ = 0.05 we required a sample size of 8 (_N_ = 7.61, Cohen method). Based on our tau−/− MCAO

data, we calculated a pre-study sample size of 4 (_N_ = 3.21) to detect a 75% difference in infarct size for the SynGAP1-knockdown MCAO study. Statistical analysis of results was done with

the Prism 6 software (GraphPad Software, USA), with tests used indicated in figure legends. Values are given as mean ± s.e. All experiments were repeated at least three times. DATA

AVAILABILITY All sequencing data have been submitted to the GEO repository and are available under accession number GSE45703. All other relevant data are available from the authors upon

request. REFERENCES * Donnan, G. A., Fisher, M., Macleod, M. & Davis, S. M. Stroke. _Lancet_ 371, 1612–1623 (2008). Article  CAS  PubMed  Google Scholar  * Sanderson, T. H., Reynolds, C.

A., Kumar, R., Przyklenk, K. & Huttemann, M. Molecular mechanisms of ischemia-reperfusion injury in brain: pivotal role of the mitochondrial membrane potential in reactive oxygen

species generation. _Mol. Neurobiol._ 47, 9–23 (2013). Article  CAS  PubMed  Google Scholar  * Hacke, W. et al. Thrombolysis with alteplase 3 to 4.5 hours after acute ischemic stroke. _N.

Engl. J. Med._ 359, 1317–1329 (2008). Article  CAS  PubMed  Google Scholar  * Kidwell, C. S. et al. A trial of imaging selection and endovascular treatment for ischemic stroke. _N. Engl. J.

Med._ 368, 914–923 (2013). Article  CAS  PubMed  PubMed Central  Google Scholar  * Campbell, B. C. et al. Endovascular therapy for ischemic stroke with perfusion-imaging selection. _N. Engl.

J. Med._ 372, 1009–1018 (2015). Article  CAS  PubMed  Google Scholar  * Berkhemer, O. A. et al. A randomized trial of intraarterial treatment for acute ischemic stroke. _N. Engl. J. Med._

372, 11–20 (2015). Article  PubMed  Google Scholar  * Schmidt, A., Minnerup, J. & Kleinschnitz, C. Emerging neuroprotective drugs for the treatment of acute ischaemic stroke. _Expert

Opin. Emerg. Drugs_ 18, 109–120 (2013). Article  CAS  PubMed  Google Scholar  * Lai, T. W., Zhang, S. & Wang, Y. T. Excitotoxicity and stroke: identifying novel targets for

neuroprotection. _Prog. Neurobiol._ 115, 157–188 (2014). Article  CAS  PubMed  Google Scholar  * Simon, R. P., Swan, J. H., Griffiths, T. & Meldrum, B. S. Blockade of

N-methyl-D-aspartate receptors may protect against ischemic damage in the brain. _Science_ 226, 850–852 (1984). Article  ADS  CAS  PubMed  Google Scholar  * Ballatore, C., Lee, V. M. &

Trojanowski, J. Q. Tau-mediated neurodegeneration in Alzheimer’s disease and related disorders. _Nat. Rev. Neurosci._ 8, 663–672 (2007). Article  CAS  PubMed  Google Scholar  * Gotz, J.,

Ittner, A. & Ittner, L. M. Tau-targeted treatment strategies in Alzheimer’s disease. _Br. J. Pharmacol._ 165, 1246–1259 (2012). Article  CAS  PubMed  PubMed Central  Google Scholar  *

Goedert, M., Spillantini, M. G., Cairns, N. J. & Crowther, R. A. Tau proteins of Alzheimer paired helical filaments: abnormal phosphorylation of all six brain isoforms. _Neuron._ 8,

159–168 (1992). Article  CAS  PubMed  Google Scholar  * Ke, Y. D. et al. Lessons from tau-deficient mice. _Int. J. Alzheimers Dis._ 2012, 873270 (2012). PubMed  PubMed Central  Google

Scholar  * Wen, Y. et al. Transient cerebral ischemia induces aberrant neuronal cell cycle re-entry and Alzheimer’s disease-like tauopathy in female rats. _J. Biol. Chem._ 279, 22684–22692

(2004). Article  CAS  PubMed  Google Scholar  * Wen, Y., Yang, S., Liu, R. & Simpkins, J. W. Transient cerebral ischemia induces site-specific hyperphosphorylation of tau protein. _Brain

Res._ 1022, 30–38 (2004). Article  CAS  PubMed  Google Scholar  * Morioka, M. et al. Hyperphosphorylation at serine 199/202 of tau factor in the gerbil hippocampus after transient forebrain

ischemia. _Biochem. Biophys. Res. Commun._ 347, 273–278 (2006). Article  CAS  PubMed  Google Scholar  * Geddes, J. W., Schwab, C., Craddock, S., Wilson, J. L. & Pettigrew, L. C.

Alterations in tau immunostaining in the rat hippocampus following transient cerebral ischemia. _J. Cereb. Blood Flow Metab._ 14, 554–564 (1994). Article  CAS  PubMed  Google Scholar  *

Dewar, D. & Dawson, D. Tau protein is altered by focal cerebral ischaemia in the rat: an immunohistochemical and immunoblotting study. _Brain. Res._ 684, 70–78 (1995). Article  CAS 

PubMed  Google Scholar  * Gordon-Krajcer, W., Kozniewska, E., Lazarewicz, J. W. & Ksiezak-Reding, H. Differential changes in phosphorylation of tau at PHF-1 and 12E8 epitopes during

brain ischemia and reperfusion in gerbils. _Neurochem. Res._ 32, 729–737 (2007). Article  CAS  PubMed  Google Scholar  * Roberson, E. D. et al. Reducing endogenous tau ameliorates amyloid

beta-induced deficits in an Alzheimer’s disease mouse model. _Science_ 316, 750–754 (2007). Article  ADS  CAS  PubMed  Google Scholar  * Ittner, L. M. et al. Dendritic Function of Tau

Mediates Amyloid-beta Toxicity in Alzheimer’s Disease Mouse Models. _Cell_ 142, 387–397 (2010). Article  CAS  PubMed  Google Scholar  * Ittner, A. et al. Site-specific phosphorylation of tau

inhibits amyloid-beta toxicity in Alzheimer’s mice. _Science_ 354, 904–908 (2016). Article  ADS  CAS  PubMed  Google Scholar  * Brott, T. & Bogousslavsky, J. Treatment of acute ischemic

stroke. _N. Engl. J. Med._ 343, 710–722 (2000). Article  CAS  PubMed  Google Scholar  * Aarts, M. et al. Treatment of ischemic brain damage by perturbing NMDA receptor- PSD-95 protein

interactions. _Science_ 298, 846–850 (2002). Article  ADS  CAS  PubMed  Google Scholar  * Mehta, A., Prabhakar, M., Kumar, P., Deshmukh, R. & Sharma, P. L. Excitotoxicity: bridge to

various triggers in neurodegenerative disorders. _Eur. J. Pharmacol._ 698, 6–18 (2013). Article  CAS  PubMed  Google Scholar  * Liu, F. & McCullough, L. D. Middle cerebral artery

occlusion model in rodents: methods and potential pitfalls. _J. Biomed. Biotechnol._ 2011, 464701 (2011). PubMed  PubMed Central  Google Scholar  * Durukan, A. & Tatlisumak, T. Acute

ischemic stroke: overview of major experimental rodent models, pathophysiology, and therapy of focal cerebral ischemia. _Pharmacol. Biochem. Behav._ 87, 179–197 (2007). Article  CAS  PubMed

  Google Scholar  * Lee, S. et al. Comparison of surgical methods of transient middle cerebral artery occlusion between rats and mice. _J. Vet. Med. Sci._ 76, 1555–1561 (2014). Article 

PubMed  PubMed Central  Google Scholar  * Liu, F., Schafer, D. P. & McCullough, L. D. TTC, fluoro-Jade B and NeuN staining confirm evolving phases of infarction induced by middle

cerebral artery occlusion. _J. Neurosci. Methods_ 179, 1–8 (2009). Article  CAS  PubMed  PubMed Central  Google Scholar  * Wang, H. B. et al. Neuroprotective effects of LBP on brain ischemic

reperfusion neurodegeneration. _Eur. Rev. Med. Pharmacol. Sci._ 17, 2760–2765 (2013). PubMed  Google Scholar  * Hartings, J. A., Williams, A. J. & Tortella, F. C. Occurrence of

nonconvulsive seizures, periodic epileptiform discharges, and intermittent rhythmic delta activity in rat focal ischemia. _Exp. Neurol._ 179, 139–149 (2003). Article  PubMed  Google Scholar

  * Li, Y., Jiang, N., Powers, C. & Chopp, M. Neuronal damage and plasticity identified by microtubule-associated protein 2, growth-associated protein 43, and cyclin D1 immunoreactivity

after focal cerebral ischemia in rats. _Stroke_ 29, 1972–1980 (1998). Article  CAS  PubMed  Google Scholar  * Palop, J. J. et al. Vulnerability of dentate granule cells to disruption of arc

expression in human amyloid precursor protein transgenic mice. _J. Neurosci._ 25, 9686–9693 (2005). Article  CAS  PubMed  Google Scholar  * Gass, P. et al. Induction of FOS and JUN proteins

after focal ischemia in the rat: differential effect of the N-methyl-D-aspartate receptor antagonist MK-801. _Acta Neuropathol._ 84, 545–553 (1992). Article  CAS  PubMed  Google Scholar  *

Crowe, S. L., Tsukerman, S., Gale, K., Jorgensen, T. J. & Kondratyev, A. D. Phosphorylation of histone H2A.X as an early marker of neuronal endangerment following seizures in the adult

rat brain. _J. Neurosci._ 31, 7648–7656 (2011). Article  CAS  PubMed  PubMed Central  Google Scholar  * Ivanov, A. et al. Opposing role of synaptic and extrasynaptic NMDA receptors in

regulation of the extracellular signal-regulated kinases (ERK) activity in cultured rat hippocampal neurons. _J. Physiol._ 572, 789–798 (2006). Article  CAS  PubMed  PubMed Central  Google

Scholar  * Nichols, R. A., Sihra, T. S., Czernik, A. J., Nairn, A. C. & Greengard, P. Calcium/calmodulin-dependent protein kinase II increases glutamate and noradrenaline release from

synaptosomes. _Nature_ 343, 647–651 (1990). Article  ADS  CAS  PubMed  Google Scholar  * Corera, A. T., Doucet, G. & Fon, E. A. Long-term potentiation in isolated dendritic spines. _PLoS

ONE_ 4, e6021 (2009). Article  ADS  PubMed  PubMed Central  Google Scholar  * Krapivinsky, G. et al. The NMDA receptor is coupled to the ERK pathway by a direct interaction between NR2B and

RasGRF1. _Neuron_ 40, 775–784 (2003). Article  CAS  PubMed  Google Scholar  * Mondragon-Rodriguez, S. et al. Interaction of endogenous tau protein with synaptic proteins is regulated by

N-methyl-D-aspartate receptor-dependent tau phosphorylation. _J. Biol. Chem._ 287, 32040–32053 (2012). Article  CAS  PubMed  PubMed Central  Google Scholar  * Brambilla, R. et al. A role for

the Ras signalling pathway in synaptic transmission and long-term memory. _Nature_ 390, 281–286 (1997). Article  ADS  CAS  PubMed  Google Scholar  * Kim, J. H., Liao, D., Lau, L. F. &

Huganir, R. L. SynGAP: a synaptic RasGAP that associates with the PSD-95/SAP90 protein family. _Neuron_ 20, 683–691 (1998). Article  CAS  PubMed  Google Scholar  * Chen, H. J., Rojas-Soto,

M., Oguni, A. & Kennedy, M. B. A synaptic Ras-GTPase activating protein (p135 SynGAP) inhibited by CaM kinase II. _Neuron_ 20, 895–904 (1998). Article  CAS  PubMed  Google Scholar  *

King, P. D., Lubeck, B. A. & Lapinski, P. E. Nonredundant functions for Ras GTPase-activating proteins in tissue homeostasis. _Sci. Signal._ 6, re1 (2013). Article  PubMed  PubMed

Central  Google Scholar  * Bell, K. F. et al. Calmodulin kinase IV-dependent CREB activation is required for neuroprotection via NMDA receptor-PSD95 disruption. _J. Neurochem._ 126, 274–287

(2013). Article  CAS  PubMed  Google Scholar  * Gladbach, A., van Eersel, J., Bi, M., Ke, Y. D. & Ittner, L. M. ERK inhibition with PD184161 mitigates brain damage in a mouse model of

stroke. _J. Neural Transm._ 121, 543–547 (2014). CAS  PubMed  Google Scholar  * Leroy, K. et al. Lack of tau proteins rescues neuronal cell death and decreases amyloidogenic processing of

APP in APP/PS1 mice. _Am. J. Pathol._ 181, 1928–1940 (2012). Article  CAS  PubMed  Google Scholar  * Holth, J. K. et al. Tau loss attenuates neuronal network hyperexcitability in mouse and

Drosophila genetic models of epilepsy. _J. Neurosci._ 33, 1651–1659 (2013). Article  CAS  PubMed  PubMed Central  Google Scholar  * Namura, S. et al. Intravenous administration of MEK

inhibitor U0126 affords brain protection against forebrain ischemia and focal cerebral ischemia. _Proc. Natl Acad. Sci. USA_ 98, 11569–11574 (2001). Article  ADS  CAS  PubMed  PubMed Central

  Google Scholar  * Osterweil, E. K. et al. Lovastatin corrects excess protein synthesis and prevents epileptogenesis in a mouse model of fragile X syndrome. _Neuron_ 77, 243–250 (2013).

Article  CAS  PubMed  PubMed Central  Google Scholar  * Oh, J. S., Manzerra, P. & Kennedy, M. B. Regulation of the neuron-specific Ras GTPase-activating protein, synGAP, by

Ca2+/calmodulin-dependent protein kinase II. _J. Biol. Chem._ 279, 17980–17988 (2004). Article  CAS  PubMed  Google Scholar  * Kim, M. J., Dunah, A. W., Wang, Y. T. & Sheng, M.

Differential roles of NR2A- and NR2B-containing NMDA receptors in Ras-ERK signaling and AMPA receptor trafficking. _Neuron_ 46, 745–760 (2005). Article  CAS  PubMed  Google Scholar  * Yang,

Y., Tao-Cheng, J. H., Reese, T. S. & Dosemeci, A. SynGAP moves out of the core of the postsynaptic density upon depolarization. _Neuroscience._ 192, 132–139 (2011). Article  CAS  PubMed

  PubMed Central  Google Scholar  * Walkup, W. Gt. et al. Phosphorylation of synaptic GTPase-activating protein (synGAP) by Ca2+/calmodulin-dependent protein kinase II (CaMKII) and

cyclin-dependent kinase 5 (CDK5) alters the ratio of its GAP activity toward Ras and Rap GTPases. _J. Biol. Chem._ 290, 4908–4927 (2015). Article  CAS  PubMed  Google Scholar  * Araki, Y.,

Zeng, M., Zhang, M. & Huganir, R. L. Rapid dispersion of SynGAP from synaptic spines triggers AMPA receptor insertion and spine enlargement during LTP. _Neuron_ 85, 173–189 (2015).

Article  CAS  PubMed  PubMed Central  Google Scholar  * Pei, L., Teves, R. L., Wallace, M. C. & Gurd, J. W. Transient cerebral ischemia increases tyrosine phosphorylation of the synaptic

RAS-GTPase activating protein, SynGAP. _J. Cereb. Blood Flow Metab._ 21, 955–963 (2001). Article  CAS  PubMed  Google Scholar  * Song, B., Yan, X. B. & Zhang, G. Y. PSD-95 promotes

CaMKII-catalyzed serine phosphorylation of the synaptic RAS-GTPase activating protein SynGAP after transient brain ischemia in rat hippocampus. _Brain Res._ 1005, 44–50 (2004). Article  CAS

  PubMed  Google Scholar  * Hamdan, F. F. et al. Mutations in SYNGAP1 in autosomal nonsyndromic mental retardation. _N. Engl. J. Med._ 360, 599–605 (2009). Article  CAS  PubMed  PubMed

Central  Google Scholar  * Carvill, G. L. et al. Targeted resequencing in epileptic encephalopathies identifies de novo mutations in CHD2 and SYNGAP1. _Nat. Genet._ 45, 825–830 (2013).

Article  CAS  PubMed  PubMed Central  Google Scholar  * Berryer, M. H. et al. Mutations in SYNGAP1 cause intellectual disability, autism, and a specific form of epilepsy by inducing

haploinsufficiency. _Hum. Mutat._ 34, 385–394 (2013). Article  CAS  PubMed  Google Scholar  * Rumbaugh, G., Adams, J. P., Kim, J. H. & Huganir, R. L. SynGAP regulates synaptic strength

and mitogen-activated protein kinases in cultured neurons. _Proc. Natl Acad. Sci. USA_ 103, 4344–4351 (2006). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  * Krapivinsky, G.,

Medina, I., Krapivinsky, L., Gapon, S. & Clapham, D. E. SynGAP-MUPP1-CaMKII synaptic complexes regulate p38 MAP kinase activity and NMDA receptor-dependent synaptic AMPA receptor

potentiation. _Neuron_ 43, 563–574 (2004). Article  CAS  PubMed  Google Scholar  * Vazquez, L. E., Chen, H. J., Sokolova, I., Knuesel, I. & Kennedy, M. B. SynGAP regulates spine

formation. _J. Neurosci._ 24, 8862–8872 (2004). Article  CAS  PubMed  Google Scholar  * Muhia, M., Feldon, J., Knuesel, I. & Yee, B. K. Appetitively motivated instrumental learning in

SynGAP heterozygous knockout mice. _Behav. Neurosci._ 123, 1114–1128 (2009). Article  PubMed  Google Scholar  * Muhia, M., Yee, B. K., Feldon, J., Markopoulos, F. & Knuesel, I.

Disruption of hippocampus-regulated behavioural and cognitive processes by heterozygous constitutive deletion of SynGAP. _Eur. J. Neurosci._ 31, 529–543 (2010). Article  PubMed  Google

Scholar  * Clement, J. P. et al. Pathogenic SYNGAP1 mutations impair cognitive development by disrupting maturation of dendritic spine synapses. _Cell_ 151, 709–723 (2012). Article  CAS 

PubMed  PubMed Central  Google Scholar  * Muhia, M. et al. Molecular and behavioral changes associated with adult hippocampus-specific SynGAP1 knockout. _Learn. Mem._ 19, 268–281 (2012).

Article  CAS  PubMed  Google Scholar  * Tucker, K. L., Meyer, M. & Barde, Y. A. Neurotrophins are required for nerve growth during development. _Nat. Neurosci._ 4, 29–37 (2001). Article

  CAS  PubMed  Google Scholar  * Connolly, E. S. Jr, Winfree, C. J., Stern, D. M., Solomon, R. A. & Pinsky, D. J. Procedural and strain-related variables significantly affect outcome in

a murine model of focal cerebral ischemia. _Neurosurgery_ 38, 523–531 (1996). PubMed  Google Scholar  * Ke, Y. D. et al. Short-term suppression of A315T mutant human TDP-43 expression

improves functional deficits in a novel inducible transgenic mouse model of FTLD-TDP and ALS. _Acta Neuropathol._ 130, 661–678 (2015). Article  CAS  PubMed  Google Scholar  * Ittner, L. M.

et al. Parkinsonism and impaired axonal transport in a mouse model of frontotemporal dementia. _Proc. Natl Acad. Sci. USA_ 105, 15597–16002 (2008). Article  Google Scholar  * Harasta, A. E.

et al. Septal Glucagon-Like Peptide 1 Receptor Expression Determines Suppression of Cocaine-Induced Behavior. _Neuropsychopharmacology_ 40, 1969–1978 (2015). Article  CAS  PubMed  PubMed

Central  Google Scholar  * von Jonquieres, G. et al. Glial promoter selectivity following AAV-delivery to the immature brain. _PLoS. ONE._ 8, e65646 (2013). Article  ADS  Google Scholar  *

Ittner, A. A., Gladbach, A., Bertz, J., Suh, L. S. & Ittner, L. M. p38 MAP kinase-mediated NMDA receptor-dependent suppression of hippocampal hypersynchronicity in a mouse model of

Alzheimer inverted question marks disease. _Acta Neuropathol. Commun._ 2, 149 (2014). Article  PubMed  PubMed Central  Google Scholar  * Fath, T., Ke, Y. D., Gunning, P., Gotz, J. &

Ittner, L. M. Primary support cultures of hippocampal and substantia nigra neurons. _Nat. Protoc._ 4, 78–85 (2009). Article  CAS  PubMed  Google Scholar  * Zhou, X., Hollern, D., Liao, J.,

Andrechek, E. & Wang, H. NMDA receptor-mediated excitotoxicity depends on the coactivation of synaptic and extrasynaptic receptors. _Cell Death Dis._ 4, e560 (2013). Article  CAS  PubMed

  PubMed Central  Google Scholar  * Ittner, L. M., Koller, D., Muff, R., Fischer, J. A. & Born, W. The N-terminal extracellular domain 23-60 of the calcitonin receptor-like receptor in

chimeras with the parathyroid hormone receptor mediates association with receptor activity-modifying protein 1. _Biochemistry_ 44, 5749–5754 (2005). Article  CAS  PubMed  Google Scholar  *

Ittner, L. M., Ke, Y. D. & Gotz, J. Phosphorylated Tau Interacts with c-Jun N-terminal Kinase-interacting Protein 1 (JIP1) in Alzheimer Disease. _J. Biol. Chem._ 284, 20909–20916 (2009).

Article  CAS  PubMed  PubMed Central  Google Scholar  * Xue, S. et al. Indian-ink perfusion based method for reconstructing continuous vascular networks in whole mouse brain. _PLoS ONE_ 9,

e88067 (2014). Article  ADS  PubMed  PubMed Central  Google Scholar  * Trapnell, C. et al. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and

Cufflinks. _Nat. Protoc._ 7, 562–578 (2012). Article  CAS  PubMed  PubMed Central  Google Scholar  * Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. _Nat.

Methods_ 9, 357–359 (2012). Article  CAS  PubMed  PubMed Central  Google Scholar  * Huang da, W., Sherman, B. T. & Lempicki, R. A. Systematic and integrative analysis of large gene lists

using DAVID bioinformatics resources. _Nat. Protoc._ 4, 44–57 (2009). Article  PubMed  Google Scholar  * Kanehisa, M., Goto, S., Sato, Y., Furumichi, M. & Tanabe, M. KEGG for

integration and interpretation of large-scale molecular data sets. _Nucleic Acids Res._ 40, D109–D114 (2012). Article  CAS  PubMed  Google Scholar  * Yasuda, R. et al. Supersensitive Ras

activation in dendrites and spines revealed by two-photon fluorescence lifetime imaging. _Nat. Neurosci._ 9, 283–291 (2006). Article  CAS  PubMed  Google Scholar  Download references

ACKNOWLEDGEMENTS The authors thank Dr Vladimir Sytnyk for help with confocal microscopy, the staff of the Biological Resources Center Wallace Wurth animal facility for continuing support

with mice, Dr Peter Davies for antibodies, and Dr David W Howells, Dr Geoffrey A Donnan (both: Florey Institute of Neuroscience and Mental Health, University of Melbourne, Australia), Dr

Edna Hardeman (University of New South Wales, Australia) and Dr Nikolas Haass (University of Queensland, Australia) for helpful comments on the manuscript. This work was supported by funding

from the National Health and Medical Research Council (NH&MRC), the Australian Research Council (ARC), the Alzheimer Association (US), Alzheimer’s Australia, the Jane Mason & Harold

Stannett Williams Memorial Foundation (Australia) and the University of New South Wales. L.M.I. is an NH&MRC Senior Research Fellow. Y.D.K. is an NH&MRC Career Development Fellow.

J.v.E. is an ARC DECRA fellow. AUTHOR INFORMATION Author notes * Mian Bi, Amadeus Gladbach and Janet van Eersel contributed equally to this work. * Yazi D. Ke and Lars M. Ittner jointly

supervised this work. AUTHORS AND AFFILIATIONS * Dementia Research Unit (DRU), School of Medical Sciences, The University of New South Wales, Sydney, NSW, 2052, Australia Mian Bi, Amadeus

Gladbach, Janet van Eersel, Arne Ittner, Magdalena Przybyla, Annika van Hummel, Sook Wern Chua, Julia van der Hoven, Wei S. Lee, Yazi D. Ke & Lars M. Ittner * Division of Cancer Genetics

and Therapeutics, Laboratory of Chromatin, Epigenetics & Differentiation, Institute of Molecular and Cell Biology, A*STAR (Agency for Science, Technology and Research), Singapore,

138673, Singapore Julius Müller & Ernesto Guccione * The Jenner Institute, University of Oxford, Old Road Campus Research Building, Roosevelt Drive, Oxford, OX3 7DQ, UK Julius Müller *

Translational Neuroscience Facility and Department of Physiology, School of Medical Sciences, The University of New South Wales, Sydney, NSW, 2052, Australia Jasneet Parmar, Georg von

Jonquieres, Gary D. Housley & Matthias Klugmann * Neuron Culture Core Facility (NCCF), The University of New South Wales, Sydney, NSW, 2052, Australia Holly Stefen & Thomas Fath *

Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore, Singapore, 117549, Singapore Ernesto Guccione * Neurodegeneration and Repair Unit (NRU), School

of Medical Sciences, The University of New South Wales, Sydney, NSW, 2052, Australia Thomas Fath * Transgenic Animal Unit, Mark Wainwright Analytical Centre, The University of New South

Wales, Sydney, NSW, 2052, Australia Lars M. Ittner * Neuroscience Research Australia (NeuRA), Sydney, NSW, 2031, Australia Lars M. Ittner Authors * Mian Bi View author publications You can

also search for this author inPubMed Google Scholar * Amadeus Gladbach View author publications You can also search for this author inPubMed Google Scholar * Janet van Eersel View author

publications You can also search for this author inPubMed Google Scholar * Arne Ittner View author publications You can also search for this author inPubMed Google Scholar * Magdalena

Przybyla View author publications You can also search for this author inPubMed Google Scholar * Annika van Hummel View author publications You can also search for this author inPubMed Google

Scholar * Sook Wern Chua View author publications You can also search for this author inPubMed Google Scholar * Julia van der Hoven View author publications You can also search for this

author inPubMed Google Scholar * Wei S. Lee View author publications You can also search for this author inPubMed Google Scholar * Julius Müller View author publications You can also search

for this author inPubMed Google Scholar * Jasneet Parmar View author publications You can also search for this author inPubMed Google Scholar * Georg von Jonquieres View author publications

You can also search for this author inPubMed Google Scholar * Holly Stefen View author publications You can also search for this author inPubMed Google Scholar * Ernesto Guccione View author

publications You can also search for this author inPubMed Google Scholar * Thomas Fath View author publications You can also search for this author inPubMed Google Scholar * Gary D. Housley

View author publications You can also search for this author inPubMed Google Scholar * Matthias Klugmann View author publications You can also search for this author inPubMed Google Scholar

* Yazi D. Ke View author publications You can also search for this author inPubMed Google Scholar * Lars M. Ittner View author publications You can also search for this author inPubMed 

Google Scholar CONTRIBUTIONS L.M.I. and Y.D.K. designed and supervised the project. M.B., A.G., J.v.E., A.I., M.P., A.v.H., S.W.C., J.v.d.H., W.S.L., J.P., T.F., G.v.J., H.S. and Y.D.K.

performed experiments. J.M. analyzed the sequencing data. E.G., G.D.H. and M.K. provided materials and expertise. L.M.I., M.B. and Y.D.K. wrote the manuscript. A.G., J.v.E., T.F., J.M.,

E.G., G.D.H. and M.K. helped with the editing of the manuscript. CORRESPONDING AUTHOR Correspondence to Lars M. Ittner. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no

competing financial interests. ADDITIONAL INFORMATION PUBLISHER'S NOTE: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional

affiliations. ELECTRONIC SUPPLEMENTARY MATERIAL SUPPLEMENTARY INFORMATION SUPPLEMENTARY DATA 1 SUPPLEMENTARY DATA 2 PEER REVIEW FILE RIGHTS AND PERMISSIONS OPEN ACCESS This article is

licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give

appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in

this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative

Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a

copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Bi, M., Gladbach, A., van Eersel, J. _et al._ Tau

exacerbates excitotoxic brain damage in an animal model of stroke. _Nat Commun_ 8, 473 (2017). https://doi.org/10.1038/s41467-017-00618-0 Download citation * Received: 23 May 2016 *

Accepted: 13 July 2017 * Published: 07 September 2017 * DOI: https://doi.org/10.1038/s41467-017-00618-0 SHARE THIS ARTICLE Anyone you share the following link with will be able to read this

content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative