ABSTRACT E2F1 and retinoblastoma (RB) tumor-suppressor protein not only regulate the periodic expression of genes important for cell proliferation, but also localize to DNA double-strand

breaks (DSBs) to promote repair. E2F1 is acetylated in response to DNA damage but the role this plays in DNA repair is unknown. Here we demonstrate that E2F1 acetylation creates a binding

motif for the bromodomains of the p300/KAT3B and CBP/KAT3A acetyltransferases and that this interaction is required for the recruitment of p300 and CBP to DSBs and the induction of histone

acetylation at sites of damage. A knock-in mutation that blocks E2F1 acetylation abolishes the recruitment of p300 and CBP to DSBs and also the accumulation of other chromatin modifying

REPAIR Article Open access 16 April 2025 HNRNPA2B1 DEACETYLATION BY SIRT6 RESTRAINS LOCAL TRANSCRIPTION AND SAFEGUARDS GENOME STABILITY Article 07 November 2024 PARYLATED PDHE1Α GENERATES

ACETYL-COA FOR LOCAL CHROMATIN ACETYLATION AND DNA DAMAGE REPAIR Article 21 September 2023 INTRODUCTION The E2F1 transcription factor regulates the expression of genes involved in cell

proliferation, apoptosis, and other cellular processes1,2. An important regulator of E2F1 is the retinoblastoma (RB) tumor-suppressor protein, which can bind and convert E2F1 from an

activator to a repressor of transcription. E2F1 activity is deregulated in most cancers by disruptions in the RB pathway but the role of E2F1 in cancer is complex as it can either promote or

inhibit tumor development depending on the context2. In addition to regulating transcription, a number of studies have revealed transcription-independent functions for E2F1 and RB in

regulating DNA repair3,4,5,6,7. E2F1 localizes to sites of DNA damage dependent on its phosphorylation at serine 31 (serine 29 in mice) by the ATM or ATR kinases8,9. The topoisomerase II

binding protein (TopBP1), which has multiple functions during the DNA damage response, specifically binds this phosphorylated form of E2F1 resulting in recruitment of E2F1 to sites of DNA

damage6,8. RB associates with E2F1 at DNA double-strand breaks (DSBs) and helps to stabilize the interaction between phosphorylated E2F1 and TopBP17. Thus there is a mutual dependence

between E2F1 and RB for their recruitment to DSBs. Consistent with this finding, the absence of RB causes the same defects in DNA end-resection and homologous recombination (HR) as is

observed in the absence of E2F17. A knock-in mutation that prevents E2F1 phosphorylation (S29A) and recruitment of E2F1 and RB to sites of DNA breaks also impairs DNA repair and renders mice

hypersensitive to ionizing radiation (IR)7. In addition to phosphorylation, E2F1 is also acetylated in response to DNA damage on three lysine residues (K117, K120, and K125 in human E2F1)

near the DNA-binding domain. Different reports have implicated PCAF/KAT2B10,11, CBP/KAT3A and p300/KAT3B12,13 and Tip60/KAT514 in mediating E2F1 acetylation. Multiple deacetylases, including

histone deacetylase 1 (HDAC1)13 and SirT115, can also regulate E2F1 acetylation levels. E2F1 acetylation can occur in the absence of E2F1 phosphorylation and independently promotes E2F1

stabilization in response to DNA damage and may also target E2F1 to specific pro-apoptotic genes, such as _p73_16. Notably, how acetylation regulates the DNA repair function of E2F1 has not

been addressed. Bromodomains specifically recognize and bind acetylated lysine motifs and are found in a number of proteins associated with chromatin and involved in transcriptional

regulation and/or DNA repair17. Small molecule inhibitors of bromodomains, such as those targeting the BET family of proteins, are emerging as promising drugs for cancers and other

diseases17,18. It is therefore important to identify the acetylated protein targets that are read and regulated by bromodomain-containing proteins. Here we demonstrate that the bromodomains

of the related p300 and CBP acetyltransferases specifically bind to the acetylated motif of E2F1. This interaction with acetylated E2F1 is critical for p300/CBP recruitment to DSBs and

induction of histone acetylation at the sites of damage. Mutating the three sites of E2F1 acetylation also impairs the recruitment of other chromatin-modifying enzymes and repair factors to

DSBs, leads to defective DNA repair, and renders mice hypersensitive to IR. These findings define a mechanism by which p300 and CBP are recruited to DSBs dependent on E2F1 and RB and reveal

crosstalk between E2F1 acetylation and histone acetylation as an important component of the DNA damage response. RESULTS THE BROMODOMAINS OF P300 AND CBP BIND TO ACETYLATED E2F1 In response

to DNA damage, human E2F1 is acetylated on lysine residues K117, K120, and K12510,12,14,16. To identify proteins that interact with this acetylated form of E2F1, we screened a protein domain

microarray with peptides that were either unacetylated or acetylated on lysine residues corresponding to K117, K120, and K125 of human E2F1 (Fig. 1a and Supplementary Fig. 1a). The

bromodomain of p300 was identified as binding to the E2F1 peptide when acetylated but not unacetylated (Fig. 1a). Peptide pull-down assays using glutathione S-transferase (GST) fusion

proteins confirmed a specific interaction between the acetylated E2F1 peptide and the bromodomain of p300 (Fig. 1b) as well as the bromodomain of the closely related acetyltransferase, CBP

(Fig. 1c). The binding was further corroborated by 1H,15N heteronuclear single quantum coherence (HSQC) nuclear magnetic resonance (NMR) titration experiments (Fig. 1d). The E2F1ac peptide

induced chemical shift perturbations in either the isolated bromodomain of p300 or the p300 construct containing bromodomain, the RING finger, and PHD finger (BRP), whereas unacetylated E2F1

peptide failed to do so (Supplementary Fig. 1b). Further analysis using mono-acetylated and di-acetylated E2F1 peptides indicates that acetylation at K125 is sufficient for binding the

bromodomains of p300 and CBP (Fig. 1b, c and Supplementary Fig. 1c). However, GST-CBP, but not GST-p300, was also efficiently pulled down using a K117 mono-acetylated peptide (Fig. 1b, c).

E2F1 is recruited to DSB sites via a phospho-specific interaction with the BRCT domain-containing protein TopBP18. We previously used a recombinant GST-TopBP1 fusion protein to specifically

pull-down the phosphorylated form of E2F1 and its associated proteins7. In addition to pulling down E2F1 and RB, the GST-TopBP1 fusion construct also pulled down endogenous p300 and CBP from

extracts made from wild-type mouse embryonic fibroblasts (MEFs) treated with IR but not from untreated MEFs (Fig. 2a). A homozygous _E2f1_ S29A knock-in mutation that prevents E2F1

phosphorylation and its interaction with TopBP1 also prevents association of p300 and CBP with the GST-TopBP1 fusion construct (Fig. 2a). GST-TopBP1 also pulled down endogenous p300 and CBP,

along with E2F1 and RB, from extracts made from human U2OS cells treated with IR but not from untreated cell extract (Fig. 2b). As we previously observed7, knocking down RB reduced the

interaction between E2F1 and TopBP1 and also prevented the IR-inducible association of p300 and CBP with GST-TopBP1. This suggests that RB helps to stabilize the interaction between p300/CBP

and the phosphorylated form of E2F1 that is recognized by TopBP1. E2F1 RECRUITS P300 AND CBP TO DNA DSBS Previous studies demonstrated that p300 and CBP are recruited to DNA breaks and

participate in local histone acetylation and remodeling of chromatin structure to facilitate repair19,20,21. However, the mechanism by which p300 and CBP are recruited to DSBs is not fully

understood. We previously used an inducible I-PpoI endonuclease system22 combined with chromatin immunoprecipitation (ChIP) to demonstrate that E2F1 and RB are enriched at DNA sequences

flanking DSBs dependent on E2F1 phosphorylation by ATM7. Using this assay, we confirmed that E2F1 and RB are recruited to an I-PpoI-induced DSB in mouse chromosome 5 (mChrom5) in primary

wild-type MEFs but not in _E2f1__S29A/S29A_ MEFs (Fig. 3a). In contrast, γH2AX is enriched at the induced DSB in both wild-type and _E2f1__S29A/S29A_ MEFs. Consistent with our finding that

p300 and CBP associate with E2F1 in response to DNA damage, p300 and CBP were also recruited to the induced DSB in wild-type MEFs but not in MEFs harboring the _E2f1_ S29A mutation (Fig. 

3a). Moreover, H3K18ac and H3K56ac, two histone acetylation marks generated by p300/CBP23,24,25,26,27, were enriched at the DSB in wild-type but not in S29A knock-in MEFs. This defect in

p300 and CBP recruitment in _E2f1__S29A/S29A_ MEFs is not due to differences in E2F1, RB, p300, or CBP protein levels (Supplementary Fig. 2a). No enrichment of E2F1, RB, p300, CBP, or H3

acetylation marks was observed at the _Gapdh_ locus, which lacks an I-PpoI cut site (Supplementary Fig. 2b). The I-PpoI cut site in mChrom5 analyzed above is located in an euchromatic

region, 5’ to _RIKEN cDNA 4930519G04_ gene. We previously demonstrated that E2F1 and RB are also recruited to an I-PpoI-induced DNA break in a heterochromatic region of mouse chromosome 10

(mChrom10)7. Both p300 and CBP were also enriched at this chromosome 10 cut site following I-PpoI induction in wild-type MEFs, as were several H3 acetylation marks mediated by these enzymes

(Supplementary Fig. 2c). However, p300 and CBP recruitment and induction of H3 acetylation at this DSB were abolished in _E2f1__S29A/S29A_ knock-in MEFs even though γH2AX was enriched as in

wild-type MEFs. Using a similar I-PpoI assay system in human U2OS cells, we find that E2F1, RB, p300, and CBP are also recruited to a DSB induced within the _DAB1_ gene on chromosome 128 and

this was associated with an induction of H3K56 acetylation (Fig. 3b). Depletion of E2F1 or RB in U2OS cells did not affect p300 or CBP protein levels (Supplementary Fig. 3a) or phospho-ATM

enrichment at the DNA break site, but it did prevent enrichment of p300, CBP, and H3K56ac (Fig. 3b). Similar results were observed at the _rDNA_ locus in U2OS cells but not at the control

_GAPDH_ locus (Supplementary Fig. 3b, c). Taken together, these findings reveal that p300 and CBP are recruited to DSBs in different chromatin environments dependent on E2F1 and RB and that

this is critical for inducing several H3 acetylation marks at the sites of damage. Incubation of wild-type MEFs with CBP112, a small molecule inhibitor specific for the bromodomains of CBP

and p30029, did not affect γH2AX induction or recruitment of E2F1 and RB to an I-PpoI-induced DSB but it did inhibit recruitment of p300 and CBP and induction of H3K18ac and H3K56ac at the

site of damage (Fig. 3c). Western blot analysis demonstrated that CBP112 treatment had little effect on the total protein levels of p300 and CBP or occupancy of p300 and CBP at the negative

control _Gapdh_ locus (Supplementary Fig. 3d, e). This indicates that the bromodomain inhibitor specifically blocks enrichment of p300 and CBP at DSBs and highlights the importance of the

bromodomains for their E2F1-dependent recruitment to DNA breaks. GENERATION OF _E2F1_ ACETYLATION-DEFICIENT MOUSE MODEL We generated a targeted mutant mouse line in which the three sites of

E2F1 acetylation were mutated from lysine to arginine and named this allele _E2f1__3KR_ (Supplementary Fig. 4a, b). Similar to _E2f1__−/−_ and _E2f1__S29A/S29A_ knock-in mouse models,

homozygous _E2f1__3KR/3KR_ knock-in mice are viable and display no obvious phenotype under unstressed conditions. RNA-sequencing (RNA-seq) analysis was performed on wild-type and

_E2f1__3KR/3KR_ MEFs, before and after treatment with the radiomimetic drug neocarzinostatin (NCS), to examine the impact of the 3KR mutation on global gene expression patterns. Expression

levels of _E2f1_ were similar between wild-type and _E2f1__3KR/3KR_ MEFs, consistent with similar E2F1 protein levels in wild-type and 3KR knock-in cells before and after DNA damage (Fig. 

4a, b). As expected, the 3KR mutation prevented E2F1 acetylation in response to DNA damage (Fig. 4c). A previous study suggested that E2F1 acetylation is involved in regulating the _p73_

gene promoter in response to DNA damage16. In primary MEFs, however, expression of _p73_ was barely detectable with very few sequence tags in each sample, independent of treatment or

genotype (Fig. 4a). In sharp contrast, the expression of _Apaf1_ and _Caspase3_, two other pro-apoptotic genes regulated by E2F30,31, are readily detectable in primary MEFs and their

expression increases in response to DNA damage (Fig. 4a). The basal expression level of _Apaf1_, but not of _Caspase3_, was lower in _E2f1__3KR/3KR_ MEFs, but induction in response to DNA

damage was similar between genotypes for both genes, and this was confirmed by reverse transcriptase real-time quantitative PCR (RT-qPCR) analysis of independent samples (Supplementary Fig. 

4c). To determine whether _p73_ expression and induction in response to DNA damage is tissue restricted, _E2f1__3KR/3KR_ and wild-type control mice were untreated or exposed to 5.5 Gy of IR

and RNA was isolated from various tissues 2 h post-IR. The expression of _p73_ was significantly induced in the thymus and spleen, but not in the liver of irradiated mice. However, contrary

to expectations, the E2F1 3KR mutation actually enhanced the induction of _p73_ expression in response to IR, although this was significant only in the spleen (Fig. 4d). Consistent with this

finding, the apoptotic response to IR in the thymus and spleen was higher in _E2f1__3KR/3KR_ mice compared to wild-type mice (Fig. 4e). Gene Set Enrichment Analysis (GSEA) was used to

analyze the RNA-seq data from primary MEFs to determine which functional pathways might be altered by the E2F1 3KR mutation. Fifty-five out of 2499 gene sets were significantly enriched

(upregulated) in wild-type cells compared to _E2f1__3KR/3KR_ mutant cells before DNA damage (Supplementary Data 1) and 96 gene sets were enriched in wild-type cells compared to

_E2f1__3KR/3KR_ cells after DNA damage (Supplementary Data 2). The majority of gene sets whose expression was significantly lower in _E2f1__3KR/3KR_ mutant cells compared to wild-type cells,

either before or after DNA damage, were related to neurodevelopment and/or differentiation. Almost 200 gene sets were found to be significantly enriched in _E2f1__3KR/3KR_ cells compared to

that in wild-type cells in the absence or presence of DNA damage, respectively. Gene sets upregulated in _E2f1__3KR/3KR_ cells were primarily involved in innate immune function

(Supplementary Data 3 and 4). Importantly, no gene sets related to DNA repair, DNA damage response, cell cycle, or apoptosis were significantly different between wild-type and

_E2f1__3KR/3KR_ knock-in MEFs, before or after DNA damage. These findings indicate that, while the E2F1 3KR mutation has a significant impact on global gene expression patterns, even in the

absence of DNA damage, genes involved in DNA damage repair and cell cycle checkpoint responses are not significantly affected. E2F1 3KR MUTATION IMPAIRS HISTONE ACETYLATION AT DSBS To

determine how mutating the sites of E2F1 acetylation impacts its recruitment to DSBs, as well as the recruitment of other factors, we performed the I-PpoI ChIP assay in primary MEFs derived

from homozygous _E2f1__3KR/3KR_ knock-in and wild-type control mice. The E2F1 3KR mutation did not significantly impact induction of γH2AX or enrichment of E2F1 and RB at a DSB located on

mChrom10 but recruitment of p300 and CBP and induction of H3K18ac and H3K56ac were abolished (Fig. 5a). This difference in recruitment was not due to differences in p300 and CBP protein

levels between genotypes before or after DNA damage induction (Fig. 5b). Similar results were obtained at another I-PpoI cut site on mChrom5 (Supplementary Fig. 5a). No enrichment of p300,

CBP, or histone H3 acetylation marks was observed in either MEF culture after I-PpoI induction at the negative control _Gapdh_ locus (Supplementary Fig. 5b). These findings are consistent

with the bromodomain inhibitor data and the model in which phosphorylation recruits E2F1 and RB to DNA breaks while E2F1 acetylation is recognized by p300 and CBP leading to their

recruitment and induction of H3 acteylation at the sites of DNA damage. To further support this model, immunofluorescence (IF) for CBP and p300 was performed to observe IR-induced foci

formation as an indicator of recruitment to DSBs. CBP and p300 both formed foci in response to IR that partially co-localized with γH2AX in wild-type MEFs (Fig. 5c, d and Supplementary Fig. 

5c). However, the E2F1 3KR mutation abolished IR-induced foci formation of p300 and CBP while γH2AX induction was unaffected. These findings again indicate an important function for E2F1

acetylation in the recruitment of p300/CBP to damaged DNA. In addition to H3 acetylation, histone H4 acetylation is also known to be induced at DSBs by the Tip60 acetyltransferase and this

is important for DNA repair and cell cycle checkpoint signaling20,32,33,34. As expected, ChIP analysis revealed Tip60 and H4K16ac enrichment at an I-PpoI-induced break on mChrom10 in

wild-type MEFs (Fig. 5e). However, mutating the sites of E2F1 phosphorylation (S29A) or acetylation (3KR) prevented Tip60 recruitment and H4K16ac induction at the DSB site (Fig. 5e). Similar

results were observed at another I-PpoI-induced cut site on mChrom5 but not at the negative control _Gapdh_ locus (Supplementary Fig. 6a, b). Depleting E2F1 or RB in U2OS cells also

impaired Tip60 recruitment and induction of H4K16ac at I-PpoI-induced DNA breaks on human chromosome 1 and the _rDNA_ locus (Fig. 5f and Supplementary Fig. 6c) but not at the _GAPDH_ locus

(Supplementary Fig. 6d). Differences in Tip60 protein levels were not responsible for the defects observed in Tip60 recruitment when E2F1 was mutated or when E2F1 and RB were depleted (Fig. 

5b and Supplementary Fig. 3a). Unlike p300 and CBP, no association was observed between Tip60 and phosphorylated E2F1 in the GST-TopBP1 pull-down assay (Supplementary Fig. 6e). This suggests

that E2F1 may regulate Tip60 recruitment or retention at DNA breaks and induction of H4 acetylation through an indirect mechanism. THE 3KR MUTATION PREVENTS BRG1 AND MRN ACCUMULATION AT

DSBS Our previous studies demonstrated that E2F1 and RB are required for the recruitment of a BRG1-containing nucleosome remodeling complex to DSBs and for decreasing nucleosome density at

the sites of damage7. To determine whether E2F1 acetylation impacts this process, _E2f1__3KR/3KR_ knock-in MEFs and the I-Ppo-I ChIP assay system were employed. The E2F1 3KR mutation did not

affect BRG1 protein levels (Supplementary Fig. 7a), but it did impair BRG1 recruitment to a DNA break (Fig. 6a). As we previously observed7, E2F1-dependent recruitment of BRG1 is associated

with decreased levels of total H3 protein at the site of damage, despite the increased levels of H3 acetylation marks (Fig. 6a). It has been suggested that BRG1-containing complexes are

recruited to DSBs through binding of the BRG1 bromodomain to acetylated histone H3 motifs19. Thus E2F1 acetylation may regulate BRG1 recruitment to DNA breaks by indirectly promoting

p300/CBP-mediated H3 acetylation. On the other hand, we previously found that BRG1 physically associates with phosphorylated E2F1 and RB in response to DNA damage, suggesting a direct role

for E2F1 in recruiting BRG1 to sites of DNA breaks7. To differentiate between these mechanisms, the GST-TopBP1 pull-down assay was performed using _E2f1__3KR/3KR_ knock-in and wild-type

control MEF extracts. The 3KR mutation did not prevent GST-TopBP1 from associating with E2F1 and RB in response to DNA damage, indicating that E2F1 phosphorylation and its interactions with

TopBP1 and RB are unaffected by the 3KR knock-in mutation (Fig. 6b). As expected, the E2F1 3KR mutation prevented association of p300 with the GST-TopBP1-E2F1 complex (Fig. 6b). The ability

of GST-TopBP1 to pull-down BRG1 was also compromised by the 3KR mutation, suggesting that E2F1 acetylation stabilizes the interaction between BRG1 and E2F1-RB (Fig. 6b). Indeed, BRG1 is

known to physically interact with p300 in the context of transcription of E2F target genes35. The Mre11-RAD50-NBS1 (MRN) complex is a key DNA damage sensor and has roles in DNA end

processing and in promoting the recruitment of various DNA repair proteins and chromatin-modifying activities to sites of damage. We previously observed that the absence of E2F1 impaired

NBS1 foci formation in response to IR, suggesting that E2F1 is important for the recruitment and/or retention of MRN at DSBs4. Indeed, NBS1 and Mre11 were both enriched at an I-PpoI-induced

DNA break in wild-type MEFs but not in _E2f1__S29A/S29A_ or _E2f1__3KR/3KR_ MEFs (Fig. 6c). The E2F1 knock-in mutations did not affect the protein levels of Mre11 or NBS1 before or after DNA

damage (Supplementary Fig. 7b). These findings confirm a role for E2F1 in the recruitment and/or retention of MRN at DNA breaks and indicates that both E2F1 phosphorylation and acetylation

are important for this process. NBS1 and Tip60 each participate in the activation of ATM at the sites of DNA damage33,36,37,38. Given that E2F1 and its posttranslational modifications are

required for the accumulation of both factors at DSBs, it might be expected that ATM activation would be impaired by the E2F1 3KR knock-in mutation. As predicted, autophosphorylation of ATM

at serine 1981, a marker of ATM activation39, was significantly reduced in response to DNA damage in _E2f1__3KR/3KR_ mutant cells compared to wild-type cells although induction of p53

phosphorylation at serine 15 and H2AX phosphorylation at serine 139 (γH2AX) was not compromised by the 3KR knock-in mutation (Fig. 6d). This suggests that low levels of active ATM, or

kinases related to ATM, are sufficient to induce normal levels of p53 and H2AX phosphorylation in _E2f1__3KR/3KR_ cells. Together, our results indicate that both E2F1 phosphorylation and

acetylation are important for the recruitment of nucleosome remodeler BRG1 and MRN complex to DSBs. THE E2F1 3KR KNOCK-IN MUTATION CAUSES DEFECTIVE DSB REPAIR As a read-out of DSB repair

competency, we measured the kinetics of γH2AX and 53BP1 foci formation and clearance following IR exposure in wild-type and _E2f1__3KR/3KR_ MEFs. The 3KR mutation does not significantly

affect γH2AX foci formation at earlier time points post-irradiation, but γH2AX foci clearance is significantly impaired at later time points in the knock-in compared to wild-type MEFs (Fig. 

7a, b). Likewise, IR-induced 53BP1 foci formation in _E2f1__3KR/3KR_ MEFs is comparable to wild-type MEFs at early time points but 53BP1 foci clearance at later time points is significantly

delayed (Fig. 7a, c). These findings suggest that the initial response to IR-induced DSBs is unaffected by the E2F1 3KR mutation but that later steps in the DSB repair process are impaired.

Cells defective for DSB repair are sensitized to chromosomal aberrations under genotoxic stress, which can lead to genome instability. To examine the impact of the E2F1 3KR mutation on

chromosome maintenance, metaphase spreads were prepared from wild-type and _E2f1__3KR/3KR_ MEFs, 48 h post-IR. As expected, _E2f1__3KR/3KR_ MEFs had a significant increase in the percentage

of cells with chromosome fusions, including dicentrics, rings, acentric, and long acrocentric chromosome-type aberrations (Fig. 7d). In addition, _E2f1__3KR/3KR_ metaphase spreads displayed

increased numbers of small fragments and tetra/polyploid cells, which account for the significantly higher aberrant metaphases in the knock-in MEFs compared to wild-type MEFs (Fig. 7d). Of

note, similar phenotypes of delayed DNA damage clearance and increased chromosome aberrations in response to genotoxic stress are also observed in _E2f1__S29A/S29A_ cells and in cells

lacking E2F1 or RB4,7. We previously demonstrated that _E2f1__S29A/S29A_ mice are hypersensitive to IR, a hallmark of defective DSB repair7. To determine the functional significance of E2F1

acetylation in vivo, _E2f1__3KR/3KR_ and wild-type sibling control mice were irradiated with 5.5 Gy of IR and maintained under sterile conditions. The majority of _E2f1__3KR/3KR_ mice did

not survive beyond 35 days following IR exposure, while 80% of wild-type siblings survived with no apparent signs of ill-health (Fig. 7e). Thus, like E2F1 phosphorylation, E2F1 acetylation

may also play an important role in maintaining organismal homeostasis and survival in response to IR. DISCUSSION Prior studies have indicated a role for E2F1 acetylation in regulating its

transcriptional activity, particularly the induction of _p73_ gene expression in response to DNA damage11,13,16. However, in primary MEF cultures we find that _p73_ gene expression is barely

detectable and unresponsive to DNA damage. On the other hand, _p73_ expression was induced in response to DNA damage in several mouse tissues, although mutation of the three sites of

acetylation in E2F1 either had no significant impact or actually enhanced this induction. To gain a better understanding of how acetylation may regulate E2F1 transcriptional activity, we

performed GSEA on RNA-seq data from primary MEFs derived from _E2f1__3KR/3KR_ and wild-type control mice, before and after the induction of DNA damage. Unexpectedly, >200 gene sets were

significantly different between wild-type and _E2f1__3KR/3KR_ cells even in the absence of DNA damage. Gene sets that were enriched in wild-type cells compared to _E2f1__3KR/3KR_ cells, and

thus likely to be positively regulated by E2F1 acetylation, were primarily related to nervous system development and differentiation (Supplementary Data 1 and 2). Importantly, gene sets

related to DNA repair, DNA damage response signaling, cell proliferation, cell cycle checkpoints, or apoptosis were not significantly different between wild-type and _E2f1__3KR/3KR_ knock-in

primary MEFs. This suggests that impaired DNA repair in _E2f1__3KR/3KR_ mutant MEFs, as indicated by delayed γH2AX and 53BP1 foci clearance and increased chromosomal aberrations following

IR exposure, is not due to an indirect effect on transcription but rather on a direct effect of E2F1 at DSB sites. Interestingly, gene sets enriched in _E2f1__3KR/3KR_ MEFs were primarily

involved in innate immunity and response to pathogens (Supplementary Data 3 and 4). Whether this is due to a direct transcriptional effect or an indirect consequence of genome instability

caused by the _E2f1_ knock-in mutation40 is at present unclear. E2F1 is recruited to DNA damage through a phospho-specific interaction with one of the BRCT domains of TopBP18. We previously

demonstrated that the RB tumor-suppressor protein associates with this phosphorylated form of E2F1 and is required for the stable interaction between E2F1 and TopBP17. E2F1 and RB in turn

recruit a BRG1-containing SWI/SNF complex to DSBs and this is associated with a decrease in total nucleosome density at the sites of damage7. We now show that an interaction between

acetylated E2F1 and the bromodomains of p300 and CBP allows E2F1 and RB to directly recruit p300/CBP to sites of DNA breaks. Our data indicate that p300 and CBP then mediate the acetylation

of multiple lysine residues on histone H3, including H3K18 and H3K56, in nucleosomes flanking DSBs. E2F1 and RB are also required for the recruitment of Tip60 and induction of H4K16ac at DNA

breaks, although this may involve an indirect mechanism rather than a direct interaction between Tip60 and E2F1 or RB (Fig. 8). Roles for p300, CBP, and Tip60 in the repair of DSBs are well

established19,20,21,23,27,32,33,41. The p300 and CBP proteins were previously shown to localize to DSBs and to be required for H3K18 acetylation and the recruitment of SWI/SNF to sites of

damage20,21. Knocking down p300 and CBP was also shown to impair H4 acetylation, the recruitment of DNA repair proteins to sites of damage, and DNA repair efficiency by both HR and

non-homologous end-joining (NHEJ) pathways20,21,25. Findings presented here are consistent with those previous studies and now establish the molecular mechanism by which p300 and CBP are

recruited to sites of DSBs dependent on RB and E2F1 posttranslational modifications. This role for E2F1 in recruiting histone acetyltransferases to regulate DNA repair is reminiscent of its

function in activating transcription, although the mechanisms by which E2F1 localizes to sites of DNA damage and target gene promoters are different42,43,44,45. Studies in the 1970s and

1980s demonstrated that histone acetylation and nucleosome remodeling occurs during the process of nucleotide excision repair (NER)46,47. Indeed, we previously demonstrated a role for E2F1

in the induction of histone acetylation and chromatin decondensation in response to ultraviolet radiation to promote efficient NER3,48. More recent studies are highlighting the role of

dynamic chromatin remodeling in facilitating the efficient repair of DSBs49,50. These studies show that, immediately after a DNA break is induced, the surrounding chromatin undergoes a

compaction involving the rapid recruitment of proteins, such as HP1, involved in mediating a repressive chromatin state51,52,53,54. However, this initial compact state is converted to an

open, relaxed chromatin state within minutes and this requires ATM-dependent phosphorylation of downstream targets, such as KAP1 and RNF20-RNF4052,55,56,57. This transition to an open

chromatin state is also associated with Tip60-mediated H4 acetylation33,50 and histone eviction at the DSB site58. We propose that p300/CBP-mediated H3 acetylation in nucleosomes surrounding

a DSB also plays an important role in this transition from a compact to a relaxed form of chromatin, perhaps upstream or co-dependent with Tip60-mediated H4 acetylation. Histone acetylation

likely cooperates with nucleolin and nucleosome-remodeling complexes, such as SWI/SNF, to reduce nucleosome density at the sites of DNA damage to allow efficient access to the DNA repair

machinery19,20,21,58. Thus E2F1 and RB may directly participate in relaxing chromatin structure at the sites of DNA damage by recruiting both BRG1-containing SWI/SNF complexes and p300/CBP.

RB is known to have multiple functions that help to preserve genome integrity independent of its role in regulating gene transcription, including maintaining heterochromatin structure at

repetitive sequences and mediating chromosome condensation and cohesion during mitosis59,60,61,62. We and others have also demonstrated direct roles for RB and E2F1 in DNA break repair by

both HR and NHEJ pathways4,5,7. Interestingly, it was recently revealed that the RB and E2F1 homologs of _Arabipodsis_, Retinoblastoma-Related (RBR) and E2FA, both co-localize with γH2AX

foci in response to DNA damage in an ATM- and ATR-dependent manner63,64. As in humans and mice, RBR and E2FA participate in the recruitment of some DNA repair factors to the sites of damage

to promote DNA repair and maintain genome integrity63,64. Whether _Arabidopsis_ RBR and E2FA recruit histone acetyltransferases and/or nucleosome remodeling complexes to DSBs is currently

unknown. Another open question is whether this direct role for E2F1 and RB homologs in DNA repair is conserved in other organisms. We previously observed that NBS1 foci formation induced in

response to DNA damage was significantly impaired when E2F1 was knocked out in mouse cells or knocked down in human cells4. This finding was confirmed and extended here using the I-PpoI ChIP

assay system, which showed impaired accumulation of NBS1 and Mre11 at DSBs in both _E2f1__S29A/S29A_ and _E2f1__3KR/3KR_ knock-in MEFs. This indicates that both E2F1 phosphorylation and

acetylation are important for the efficient loading of the MRN complex on chromatin flanking DNA break sites. The MRN complex has multiple functions in DNA repair and DNA damage response

signaling and its impaired accumulation at DSBs could explain several phenotypes observed in E2F1 mutant cells. The MRN complex is important for DNA end processing and resection to generate

the single-stranded DNA required for HR repair as well as alternative NHEJ, also known as microhomology repair65. NBS1 also directly binds ATM and participates in the activation of ATM to

amplify DNA damage response signaling36,38, consistent with the reduced ATM autophosphorylation observed in E2F1 mutant cells. Moreover, the MRN complex participates in the eviction of

histones at the sites of DSBs by directly binding to and recruiting the histone chaperone nucleolin58. It remains unclear exactly how E2F1 knock-in mutations impair the accumulation of MRN

at DSB sites. Previous studies have demonstrated impaired accumulation of MRN at the sites of DNA damage in cells depleted for Tip60, and this was associated with defective histone

acetylation41,66. This suggests that E2F1-dependent changes in chromatin structure may indirectly promote the loading of MRN on chromatin flanking DSBs. On the other hand, E2F1 interacts

with the N-terminus of NBS1, which could indicate a direct role for E2F1 in the recruitment and/or retention of MRN at the sites of DNA damage67. These possibilities are not mutually

exclusive and E2F1 may promote MRN enrichment at DSBs by both direct and indirect mechanisms. Indeed, RB is also known to physically associate with several DNA repair proteins, including

components of the NHEJ repair pathway5. These interactions, together with the E2F1–p300/CBP interaction defined here, could allow E2F1 and RB to coordinate the modification of chromatin

structure with the assembly of DNA repair machinery at the sites of DSBs. METHODS GENERATION OF A TARGETED _E2F1_ _3KR_ KNOCK-IN ALLELE A custom-made zinc finger nuclease (ZFN, Sigma) was

designed to target mouse _E2f1_ sequences in exon 3 (AAACGGCGCATCTTATGACATCaccaatgtc, where the uppercase letters indicate the ZFN recognition sequence and lowercase letters represent the

Folk1 cut site), approximately 70 bases 3’ to the nearest codon encoding the three sites of E2F1 acetylation. A 1996 base pair donor construct was then designed (Genescript) to mutate codons

112, 115, and 120 (corresponding to human codons K117, K120, and K125 in humans) to alter protein coding from lysine to arginine (3KR mutation). One of these changes also resulted in the

generation of unique _Bgl II_ recognition site, as shown in Supplementary Fig. 4a. In addition, silent point mutations were also introduced into the donor construct to destroy the ZFN

recognition sequence without affecting protein sequence. The isolated donor sequence fragment and mRNAs encoding the _E2f1_-targeting ZFN were given to the Transgenic Animal Facility at the

University of Texas MD Anderson Cancer Center, Science Park for generating founder knock-in mice (FVB strain) by pronuclear injection. Genomic DNA from the resultant pups was isolated and

PCR was used to clone _E2f1_ sequences that included the targeted codons and ZFN recognition site (forward primer: AGACATCAGACTGGGGTTGG, reverse primer: TGACAGCAAAAGCTGGAATG). Targeted

alleles were identified by digestion with _Bgl_ II and sequencing of _E2f1_ exons 2–4 was performed to confirm the presence of the targeted mutations and absence of unintended mutations. A

correctly targeted founder mouse was crossed to a wild-type mouse and F1 mice positive for the _E2f1__3KR_ allele were further backcrossed to wild-type mice before heterozygous mice were

crossed to generate homozygous _E2f1__3KR/3KR_ mice. ANIMAL MODELS Wild-type, _E2f1__S29A/S29A_, and _E2f1__3KR/3KR_ knock-in mice are FVB strains. The wild-type FVB mice (3–4 weeks old) are

purchased (Harlan Laboratories, IN) and the knock-in lines are produced in house. Generation of _E2f1__S29A/S29A_ knock-in mouse model was described earlier3 and the strain details are

deposited to Mouse Genome Informatics (MGI ID: 5755411) with a symbol of FVB.Cg-E2f1tm1.1Dgj. Development of _E2f1__3KR/3KR_ knock-in mouse model is described above and submitted to MGI

(Symbol: E2f1em1Dgj, ID: 6313577). MAINTENANCE OF MICE Wild-type, _E2f1__S29A/S29A_, and _E2f1__3KR/3KR_ knock-in mice of both sex from each strain up to age 1 year were maintained in an

AAALAC-accredited facility in individually ventilated cages (Micro-isolator Housing Unit; Allentown Inc, NJ) sterilized together with aspen chip bedding (Aspen Sani-chips; P.J. Murphy Forest

Products Corporation, NJ). Purina Irradiated Breeder Diet (Lab Diet #5058) was provided ad libitum and acidified reverse osmosis water was provided by an automated system. Cages were

maintained in a room where temperature and humidity were 20–22 °C and 55%, respectively, with a 14-h light and 10-h dark cycle and a minimum of 12 air changes per hour. Mice of both sex were

randomly allocated to experiments at the age of 6–8 weeks. All animal experiments complied with the National Research Council’s guide for the Care and Use of Laboratory Animals and were

approved by the University of Texas MD Anderson Institutional Animal Care and Use Committee. CELL LINES AND PRIMARY CELL CULTURES Primary MEFs of wild-type, _E2f1__S29A/S29A_, and

_E2f1__3KR/3KR_ knock-in mice were isolated from 13.5-day-old embryos derived from crossing heterozygous or homozygous mice of each strain following standard procedures and maintained in

Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco), penicillin– streptomycin, and 100 μm β-mercaptoethanol at 37 °C in 5% CO2

and 5% O2. U2OS cells were obtained from American Type Culture Collection (ATCC, #HTB-96) and infected with lentiviral particles expressing short hairpin RNA (shRNA) targeting _RB1_ or

_E2F1_7. U2OS parental and shRNA-expressing cell lines were maintained in DMEM supplemented with 10% FBS (Sigma) and penicillin–streptomycin at 37 °C in 5% CO2. TREATMENT CONDITIONS AND

REAGENTS IR treatment of human and mouse cell lines and of mice was performed with an RS-2000 biological irradiator (Rad Source) with the indicated doses. Where indicated, MEFs were treated

with 1 μM p300/CBP bromodomain-specific inhibitor I-CBP112 and 250 ng/ml of radiomimetic drug NCS. The information of reagents and resources used in this study can be found in Supplementary

Table 1 or in each method’s section. CADOR 5.0 PROTEIN DOMAIN MICROARRAY CADOR 5.0 chip68 has 174 GST fusion proteins, arrayed in duplicate on a nitrocellulose slide. The layout of the array

is shown in Supplementary Fig. 1a. The middle position (M) contains GST alone as a background indicator. The list of arrayed GST fusion proteins, accession numbers, and regions cloned can

be found elsewhere68,69. The complementary DNAs (cDNAs) encoding the domains listed were cloned into the pGEX-6P1 vectors by PCR using a human cDNA library (Origene, MD) and verified by DNA

sequencing68. Peptides were synthesized by W. M. Keck Biotechnology Resource Center (New Haven, CT) and CPC Scientific (Sunnyvale, CA). E2F1 peptides corresponding to human E2F1 amino acids

(aa) 111–131 mono-acetylated at K117, K120, or K125; di-acetylated at 117/120, 117/125, and 120/125; tri-acetylated at each site (3KAc); or unacetylated (UnAc) were synthesized: E2F1 UnAc:

biotin-RGRHPGKGVKSPGEKSRYETS-NH2 E2F1 3KAc: biotin-RGRHPGK*GVK*SPGEK*SRYETS-NH2 E2F1 K117Ac: biotin-RGRHPGK*GVKSPGEKSRYETS-NH2 E2F1 K120Ac: biotin-RGRHPGKGVK*SPGEKSRYETS-NH2 E2F1 K125Ac:

biotin-RGRHPGKGVKSPGEK*SRYETS-NH2 E2F1 K117/120Ac: biotin-RGRHPGK*GVK*SPGEKSRYETS-NH2 E2F1 K117/125Ac: biotin-RGRHPGK*GVKSPGEK*SRYETS-NH2 E2F1 K120/125Ac: biotin-RGRHPGKGVK*SPGEK*SRYETS-NH2

K* = acetylated lysine Biotinylated peptides (10 μg) were pre-bound to 5 μl of Cy3–streptavidin or Cy5–streptavidin (FluorolinkTM; Amersham Pharmacia Biotech) in 500 μl of phosphate-buffered

saline (PBS)–Tween 20 (PBST). The fluorescently labeled peptide was then incubated with 20 μl of biotin–agarose beads to remove the free streptavidin label. Arrayed slides were blocked in

PBST containing 3% (w/v) powdered milk, followed by the addition of 400 μl of fluorophore-tagged peptide. Blocking and hybridization were performed in an Atlas Glass Hybridization Chamber

(Clontech). After incubation and washes, the slides were centrifuged to dry. Fluorescent signal was detected by GenePix 4200A Microarray Scanner (Molecular Devices), with the GenePix Pro

Microarray Analysis Software (Molecular Devices). A 532 nm long pass filter was used for the detection of Cy3-labeled probes and fluorescein isothiocyanate-conjugated secondary antibodies. A

635 nm band pass filter was used for the detection of Cy5-labeled probes. A positive signal is seen as two dots at varying angles. PEPTIDE PULL-DOWN ASSAY Biotinylated peptides (15 μg) were

immobilized on 25 μl of streptavidin beads in 500 μl of 1× mild buffer (50 mM Tris–HCl pH 7.5, 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 15 mM MgCl2, and 0.1% NP-40), then incubated with 2–3 μg of

GST fusion protein for 1 h. After washing, the beads were boiled in Laemmli buffer, separated by 10% sodium dodecyl sulfate (SDS)–polyacrylamide gel electrophoresis (PAGE) and subjected to

western blot analysis using an anti-GST antibody. PURIFICATION OF GST FUSION PROTEINS For NMR titration assays, GST fusion p300-BD (1040–1161 aa) and His-6x fusion p300-BRP (1051–1278 aa)

proteins were expressed in minimal media supplemented with 50–150 μM ZnCl2 and 15NH4Cl. After induction with 0.4–1.0 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) for 18 h at 16 °C,

bacteria were harvested through centrifugation and lysed by sonication. GST fusion proteins were purified on glutathione-Agarose 4B beads (Thermo Fisher Sci) and the GST tag was cleaved with

PreScission protease. His-tagged proteins were purified on Ni-NTA agarose beads and washed and eluted with imidazole. The His-tag was removed by cleavage with PreScission protease. Proteins

were concentrated using Millipore concentrators (Millipore). For GST pull-down and peptide pull-down assays, indicated GST-fusion proteins were overexpressed in _Escherichia coli_ DH5α

cells (Life Technologies) by induction with a final concentration of 0.1 mM IPTG at 30 °C for 4 h. Cells were pelleted and resupended in PBS, then subjected to sonication. The resulting

lysates were centrifuged at maximum speed for 10 min, and the GST fusion proteins were then batch-purified from extracts by binding to glutathione–Sepharose 4B beads and washed in PBS

according to the manufacturer’s instructions. The purified proteins were eluted from the beads with elution buffer (30 mM Glutathione reduced, 100 mM Tris-HCl, pH 8.0, and 120 mM NaCl). The

purified proteins were stored in the elution buffer at −80 °C. NMR EXPERIMENTS NMR experiments were performed at 298 K on a Varian INOVA 600 MHz spectrometer. 1H,15N HSQC spectra of

uniformly 15N-labeled p300 BD or BRP (0.1–0.15 mM) in buffer (BD: 25 mM Tris at pH 6.8, 150 mM NaCl, 2 mM dithiothreitol or BRP: 10 mM Hepes, 150 mM NaCl, 2% glycerol) and ~8% D2O were

collected as E2F1 peptides were added stepwise into the protein samples. NMR data were processed and analyzed with NMRPipe and NMRDraw70. NMRPipe is from NIST IBBR and available at

https://www.ibbr.umd.edu/nmrpipe/index.html GST PULL-DOWN AND IP BLOTTING For GST pull-down experiments, cells were treated as indicated and harvested in cold PBS followed by resuspension in

cell lysis buffer (20 mM Tris at pH 7.5, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 1 mM EGTA, 2.5 mM Sodium pyrophosphate, protease inhibitor cocktail, phosphatase inhibitor, and HDAC

inhibitors - 300 nM TSA, 2 μM EX-527). After aliquoting 5% of the lysates as input, 1–2 mg of lysates were pre-cleared by incubating with 25 μg of purified GST for 2 h at 4 °C and pulled

down using glutathione-Sepharose 4B beads as per the manufacturer’s directions. Pre-cleared lysates were divided equally to incubate with 15 μg of purified GST or GST-TopBP1 overnight at 4 

°C. Next day, pull-down was performed using glutathione beads. Both samples and input were mixed with Laemmli buffer, boiled for 5 min, separated by SDS-PAGE, and subjected to western blot

analysis7. See Supplementary Table 2 for the list of antibodies used. For co-immunoprecipitation, cell lysates were prepared as mentioned above. Four hundred μg of lysates were pre-cleared,

followed by IP with IgG control or 2.5 μg of antibody to E2F1 (C-20) and pulled down by protein G magnetic beads (Cell Signaling Technology). Immunocomplexes were eluted by boiling the beads

with Laemmli buffer, followed by western blotting with acetylated lysine or E2F1. For western blot analysis of cell lysates, 15–100 μg of samples were mixed with Laemmli buffer, boiled for

5 min, run on SDS-PAGE, and then transferred onto a polyvinylidene difluoride membrane (Amersham Hybond). Blots were blocked in PBS–Tween 20 (PBST) or TBST containing 5% non-fat dry milk or

bovine serum albumin respectively, and then incubated with primary antibody in the blocking buffer overnight at 4 °C. The list of antibodies used in this study is given in Supplementary

Table 2. After washing and incubating with horseradish peroxidase (HRP)-conjugated secondary antibodies (Santa Cruz Biotechnology and Abcam), the membrane was subjected to ECL (Enhanced

Chemiluminescence) detection as per the supplier’s instructions. Signal was exposed to Autorad film (GeneMate) and developed using Medical Film processor (Konica Minolta SRX-101A). CHIP AND

QPCR Transduction of MEFs and U2OS cells with retrovirus expressing HA-ER*-I-PpoI enzyme was performed twice to increase infection efficiency and treated with 2 μM 4-hydroxy tamoxifen

(Sigma) for 12 h to induce DNA damage22. Cells were crosslinked by adding formaldehyde (1% final concentration) followed by quenching with glycine (Sigma) at 1.25 mM final concentration,

then harvested. Cell pellets were resuspended in SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris at pH 8.1, protease inhibitor cocktail, phosphatase inhibitor, and HDAC inhibitors - 300 nM

TSA, 2 μM EX-527) and the lysates were sonicated. After diluting with ChIP dilution buffer (0.01% SDS, 1.2 mM EDTA, 16.7 mM Tris at pH 8.1, 1.1% Triton X-100, 167 mM NaCl, protease inhibitor

cocktail, phosphatase inhibitor, and HDAC inhibitors - 300 nM TSA, 2 μM EX-527), the lysates were pre-cleared and subjected to IP with the antibodies indicated (Supplementary Table 2). In

all, 10% input was aliquoted separately. Next day, the DNA-bound immunocomplexes were pulled down by ChIP-Grade Protein G Magnetic beads and subjected to serial washes with buffers of low

salt, high salt, LiCl, and TE. Then the crosslinked DNA was eluted with Elution buffer (1% SDS and 0.1 M NaHCO3) at 65 °C. Subsequently, the samples including input were incubated with 5 M

NaCl at 65 °C overnight for reverse crosslinking. After RNase A (Sigma) and Proteinase K (Sigma) treatment, the DNA was eluted using the QIAquick PCR Purification Kit (Qiagen) as per the

manufacturer’s instructions. Occupancy of the DNA-bound proteins was measured by subjecting eluted DNA to qPCR using 7500 Fast Real-Time PCR system (Applied Biosystems) with primers for the

indicated loci. Primers are listed in Supplementary Table 3. The percentage of input was calculated by dividing the amount of DNA obtained from the IP of the given factor by the total amount

of DNA (input) and normalized for background signal (non-specific IgG control). Each experiment was carried out in triplicate and the results were expressed as relative enrichment, which

represents the ratio between the normalized percentage of input of infected cells and uninfected cells. IR TREATMENT OF MICE AND SURVIVAL STUDY POST-IR Pups of wild-type and _E2f1__3KR/3KR_

strain were weaned at 21 days according to sex, then aged to 6–8 weeks prior to IR treatment. Mice were shifted to IR treatment room and transferred into sterile treatment cages in the

biosafety cabinet. After 5.5 Gy of irradiation (up to 5 mice per treatment cage), they were returned to biosafety hood and transferred into sterile cages (with sterile feed, bedding, and

water containing 50 mg/ml of Clavamox). In the biosafety hood, antibiotic water bottles were changed out every 5 days and cages were changed out every 7 days for animals remaining housed

after treatment. Mice were group housed if possible; single housed if need to prevent fighting. Mice were monitored daily for symptoms of ill-health and were euthanized if they became

moribund as per federal and institutional guidelines. CLEAVED LAMIN A STAINING AND IMMUNOHISTOCHEMISTRY (IHC) Wild-type and _E2f1__3KR/3KR_ mice were subjected to IR treatment as described

above and sacrificed 2 h later. Thymus and spleen tissues were collected, mounted on to cassettes, fixed in 10% neutral buffered formalin for 24–48 h, and then moved to 70% ethanol and

paraffin embedded. Tissue sections were deparaffinized in xylene or xylene substitute followed by graded alcohols (100%, 95% Ethanol) to water. Endogenous peroxidase activity was blocked

with 3% H2O2 for 10 min in water. Antigen was retrieved with 10 mM Citrate Buffer at pH 6.0 in a microwave oven for 3 min at 100% power followed by 15 min at 50% power, then cooled down for

20 min. Binding of non-specific antibody was blocked by incubating the slides with blocking reagent (Biocare Medical) for 10 min. Then the slides were incubated with primary cleaved Lamin A

antibody overnight at 4 °C (refer Supplementary Table 2 for antibody information). Next, these were washed twice and incubated with Envision plus labeled polymer and anti-rabbit-HRP (Dako)

for 30 min at room temperature. After washing twice, these were incubated with DAB (Dako) for monitoring staining development. Finally, these were counterstained and dehydrated, and

coverslips were placed on the slides for viewing. A set of 48 glass slides stained for IHC Lamin A were scanned by using the Aperio ScanScope imaging platform (Leica Biosystems, IL) with a

×20 objective at a spatial sampling period of 0.47 μm/pixel. After saving each digital image, a Genie classifier algorithm was trained to quantitate cleaved Lamin A-positive and -negative

nuclei. Whole-slide images were viewed and analyzed by using desktop personal computers equipped with the free ScanScope software. RNA ISOLATION AND QPCR OF GENE EXPRESSION Total RNA was

isolated from wild-type and knock-in MEFs before and 3 h after treatment with NCS using the GenElute mammalian Total RNA Miniprep Kit (Sigma) following the supplier’s instructions. For

tissue samples, wild-type and _E2f1__3KR/3KR_ mice were subjected to 5.5 Gy of IR treatment and sacrificed 2 h later. Thymus, spleen, and liver tissues were collected and subjected to total

RNA isolation using the same kit as per the instructions. On-column DNase I digestion was performed for all samples before eluting the RNA. Five hundred ng of total RNA was used to prepare

cDNA using SuperScript II Reverse transcriptase with random hexamer primer. cDNAs were subjected to real-time qPCR with gene-specific primers. Primers are listed in Supplementary Table 3.

Relative mRNA quantification was performed by comparative _C_T method using _Gapdh_ as an internal control. RNA-SEQ AND GSEA Total RNA was isolated from wild-type and _E2f1__3KR/3KR_ MEFs

before and 3 h after treatment with NCS using the GenElute mammalian Total RNA Miniprep Kit (Sigma) following the supplier’s instructions. DNase I-treated RNA samples were fragmented and

tagged at both ends for stranded library preparation using the TrueSeq Stranded mRNA Kit (Illumina). The mRNA-seq run was performed on the HiSeq 3000 platform (Illumina). Approximately 40–60

million reads were acquired per sample. The differential expression analysis for mRNA-seq data was performed with DESeq2 bioconductor R package with the cutoff of False Discovery Rate (FDR)

_q_ ≤ 0.05. The normalized read count was generated from built-in function in DESeq2. Sequenced tags were analyzed by GSEA downloaded from Broad Institute at

http://software.broadinstitute.org/gsea/index.jsp. The mouse gene sets for Gene Ontology (GO) was prebuilt and can be downloaded from http://www.bioinformatics.org/go2msig/. The high-quality

GO annotations for biological process GO terms with MsigDB format (.gmt) were utilized. Additional two input files, expression dataset file (.txt) and phenotype labels file (.cls), were

generated according to the file formats described in GSEA user guide and GSEA data format guide. IF STAINING AND CONFOCAL MICROSCOPY Wild-type and _E2f1__3KR/3KR_ MEFs (0.5 × 106 cells) were

seeded on 35 mm FluoroDish with 0.17 mm cover glass bottom (World Precision Instruments), 24 h prior to experiment. For γH2AX and 53BP1 foci formation and clearance assay, cells were

treated with IR and, at the indicated times, rinsed with cold PBS, and fixed for 15 min at room temperature in 4% paraformaldehyde and 1% sucrose. For CBP and p300 IF experiments, cells were

irradiated, harvested 2 h post-IR, and subjected to in situ extraction protocol as follows. After rinsing with cold PBS, cells were incubated 5 min on ice with pre-extraction buffer (25 mM

HEPES pH 7.5, 50 mM NaCl, 1 mM EDTA, 3 mM MgCl2, 300 mM Sucrose, 0.5% Triton X-100), followed by 5-min incubation on ice with stripping buffer (10 mM Tris pH 7.4,10 mM NaCl, 3 mM MgCl2, 1 mM

EDTA, 1% Tween-20, 0.5% Na-Deoxycholate), and fixed as above. After washing, cells were permeabilized with 0.5% Triton X-100 and blocked in Background Sniper for 15 min. Antibodies against

CBP, p300, γH2AX, and 53BP1 were diluted with DaVinci Green antibody diluent and incubated with the cells overnight at 4 °C (See Supplementary Table 2 for antibody information). After

washing, cells were incubated with appropriate fluorophore-conjugated secondary antibodies (Thermo Fisher Sci), stained with 4,6-diamidino-2-phenylindole and mounted in SlowFade Diamond

Anti-fade mountant (Thermo Fisher Sci). Laser scanning confocal microscopy was performed using a Zeiss LSM880 and ×63 oil (1.4 NA) Plan/Apo objective with a pinhole aperture of 1–1.5 AU.

Foci quantification of 5 × 5 tile scans were performed using the Imaris (Bitplane, v9.0) image analysis software. Cells module and custom algorithms specific to CBP, p300, γH2AX and 53BP1

foci. Each treatment group was in triplicate, and in total at least 450 cells were counted per treatment group. Images were captured and processed using identical microscope settings and

foci parameters. METAPHASE CHROMOSOME SPREAD PREPARATION Wild-type and _E2f1__3KR/3KR_ MEFs were irradiated as indicated and, 38 h after treatment, incubated with 0.1 μg/ml colcemid for 10 

h. Cells were trypsinized, pelleted down, kept in a hypotonic solution (0.075 M KCl) for 15 min at room temperature, then fixed with 1:3 acetic acid:methanol, and spread on a slide.

Metaphase chromosome aberrations of breaks, dicentrics, rings, chromosome fusions, fragments, and other aberrations were analyzed by Nikon Microscope with ×63 oil immersion objective. Images

were taken using Imaging system from Applied Spectral Imaging (Carlsbad, CA). Approximately, 150 metaphases were counted per treatment. Each treatment group was set up in triplicate, and at

least 50 metaphases were counted per sample in the triplicate. STATISTICAL INFORMATION For statistical analysis of mice survival curve, a Kaplan–Meier estimate was generated and analyzed

for statistical significance with log-rank test. The difference in the survival rates between genotypes is highly significant with values of _P_ < 0.0001. All other quantitative

experiments were carried out in triplicate, and graphs represent average ± standard deviation (SD). Statistical analysis was performed using unpaired Student’s _t_ test for all experiments

except foci quantification by IF staining in which unpaired Mann–Whitney _U_ test was used. Significance was determined, with _P_ ≤ 0.05 (*) considered to be significant and _P_ ≤ 0.01 (**)

and _P_ < 0.0001 (****) are considered to be highly significant. For GSEA of RNA-seq data, significantly enriched pathways between genotypes were determined with cutoff of FDR value, _q_ 

≤ 0.05. REPORTING SUMMARY Further information on research design is available in the Nature Research Reporting Summary linked to this article. DATA AVAILABILITY Knock-in mouse models used in

this study are registered in Mouse Genome Informatics (MGI) database. Strain details of _E2f1__S29A/S29A_ (FVB.Cg-E2f1tm1.1Dgj) can be found in MGI ID:5755411

[http://www.informatics.jax.org/allele/MGI:5637520] and _E2f1__3KR/3KR_ (E2f1em1Dgj) in MGI ID:6313577 [http://www.informatics.jax.org/allele/key/882523]. RNA-seq data are available in Gene

Expression Omnibus (GEO) repository under accession GSE135360. All data supporting the findings of this study are available within the article and its supplementary information files.

Additional information and relevant data will be available from the corresponding author upon reasonable request. Supplementary Data 5 contains raw data of blots/gels underlying Fig. 1b, c;

2a, b; 4b, c; 5b; 6b, d; and Supplementary Figs. 1c; 2a; 3d; 4b; 6e; 7a, b. Source Data file contains raw data of all reported averages in graphs and charts underlying main figures, Fig. 

3a–c; Fig. 4a, d and e; Fig. 5a, d–f; Fig. 6a and c; Fig. 7b–e; and Supplementary Figs. 2b, c; 3b, c and e; 4c; 5a–c and 6a–d. CODE AVAILABILITY Data in this manuscript are generated using

commonly available commercial software and algorithms and are detailed in the corresponding “Methods” section. Specific computer code is not applicable. REFERENCES * DeGregori, J. &

Johnson, D. G. Distinct and overlapping roles for E2F family members in transcription, proliferation and apoptosis. _Curr. Mol. Med._ 6, 739–748 (2006). CAS  PubMed  Google Scholar  *

Johnson, D. G. & Degregori, J. Putting the oncogenic and tumor suppressive activities of E2F into context. _Curr. Mol. Med._ 6, 731–738 (2006). CAS  PubMed  Google Scholar  * Biswas, A.

K., Mitchell, D. L. & Johnson, D. G. E2F1 responds to ultraviolet radiation by directly stimulating DNA repair and suppressing carcinogenesis. _Cancer Res_. 74, 3369–3377 (2014). * Chen,

J. et al. E2F1 promotes the recruitment of DNA repair factors to sites of DNA double-strand breaks. _Cell Cycle_ 10, 1287–1294 (2011). Article  CAS  PubMed  PubMed Central  Google Scholar 

* Cook, R. et al. Direct involvement of retinoblastoma family proteins in DNA repair by non-homologous end-joining. _Cell Rep._ 10, 2006–2018 (2015). Article  CAS  PubMed  PubMed Central 

Google Scholar  * Guo, R. et al. E2F1 localizes to sites of UV-induced DNA damage to enhance nucleotide excision repair. _J. Biol. Chem._ 285, 19308–19315 (2010). Article  CAS  PubMed 

PubMed Central  Google Scholar  * Velez-Cruz, R. et al. RB localizes to DNA double-strand breaks and promotes DNA end resection and homologous recombination through the recruitment of BRG1.

_Genes Dev._ 30, 2500–2512 (2016). Article  CAS  PubMed  PubMed Central  Google Scholar  * Liu, K., Lin, F. T., Ruppert, J. M. & Lin, W. C. Regulation of E2F1 by BRCT domain-containing

protein TopBP1. _Mol. Cell. Biol._ 23, 3287–3304 (2003). Article  CAS  PubMed  PubMed Central  Google Scholar  * Lin, W. C., Lin, F. T. & Nevins, J. R. Selective induction of E2F1 in

response to DNA damage, mediated by ATM- dependent phosphorylation. _Genes Dev._ 15, 1833–1844 (2001). CAS  PubMed  PubMed Central  Google Scholar  * Ianari, A., Gallo, R., Palma, M.,

Alesse, E. & Gulino, A. Specific role for PCAF acetylytransferase activity in E2F1 stabilization in response to DNA damage. _J. Biol. Chem._ 279, 20830–30835 (2004). Article  CAS  Google

Scholar  * Martinez-Balbas, M. A., Bauer, U. M., Nielsen, S. J., Brehm, A. & Kouzarides, T. Regulation of E2F1 activity by acetylation. _EMBO J._ 19, 662–671 (2000). Article  CAS 

PubMed  PubMed Central  Google Scholar  * Galbiati, L., Mendoza-Maldonado, R., Gutierrez, M. I. & Giacca, M. Regulation of E2F-1 after DNA damage by p300-mediated acetylation and

ubiquitination. _Cell Cycle_ 4, 930–939 (2005). Article  CAS  PubMed  Google Scholar  * Marzio, G. et al. E2F family members are differentially regulated by reversible acetylation. _J. Biol.

Chem._ 275, 10887–10892 (2000). Article  CAS  PubMed  Google Scholar  * Van Den Broeck, A., Nissou, D., Brambilla, E., Eymin, B. & Gazzeri, S. Activation of a Tip60/E2F1/ERCC1 network

in human lung adenocarcinoma cells exposed to cisplatin. _Carcinogenesis_ 33, 320–325 (2012). Article  CAS  Google Scholar  * Wang, C. et al. Interactions between E2F1 and SirT1 regulate

apoptotic response to DNA damage. _Nat. Cell Biol._ 8, 1025–1031 (2006). Article  CAS  PubMed  Google Scholar  * Pediconi, N. et al. Differential regulation of E2F1 apoptotic target genes in

response to DNA damage. _Nat. Cell Biol._ 5, 552–558 (2003). Article  CAS  PubMed  Google Scholar  * Ferri, E., Petosa, C. & McKenna, C. E. Bromodomains: structure, function and

pharmacology of inhibition. _Biochem. Pharmacol_. 106, 1–18 (2015). * Chiu, L. Y., Gong, F. & Miller, K. M. Bromodomain proteins: repairing DNA damage within chromatin. _Philos. Trans.

R. Soc. Lond. B Biol. Sci_. 372, 20160286 (2017). * Lee, H. S., Park, J. H., Kim, S. J., Kwon, S. J. & Kwon, J. A cooperative activation loop among SWI/SNF, gamma-H2AX and H3 acetylation

for DNA double-strand break repair. _EMBO J._ 29, 1434–1445 (2010). Article  CAS  PubMed  PubMed Central  Google Scholar  * Ogiwara, H. et al. Histone acetylation by CBP and p300 at

double-strand break sites facilitates SWI/SNF chromatin remodeling and the recruitment of non-homologous end joining factors. _Oncogene_ 30, 2135–2146 (2011). Article  CAS  PubMed  Google

Scholar  * Qi, W. et al. Acetyltransferase p300 collaborates with chromodomain helicase DNA-binding protein 4 (CHD4) to facilitate DNA double-strand break repair. _Mutagenesis_ 31, 193–203

(2016). Article  CAS  PubMed  Google Scholar  * Berkovich, E., Monnat, R. J. Jr. & Kastan, M. B. Assessment of protein dynamics and DNA repair following generation of DNA double-strand

breaks at defined genomic sites. _Nat. Protoc._ 3, 915–922 (2008). Article  CAS  PubMed  Google Scholar  * Das, C., Lucia, M. S., Hansen, K. C. & Tyler, J. K. CBP/p300-mediated

acetylation of histone H3 on lysine 56. _Nature_ 459, 113–117 (2009). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  * Jin, Q. et al. Distinct roles of GCN5/PCAF-mediated H3K9ac

and CBP/p300-mediated H3K18/27ac in nuclear receptor transactivation. _EMBO J._ 30, 249–262 (2011). Article  CAS  PubMed  Google Scholar  * Ogiwara, H. & Kohno, T. CBP and p300 histone

acetyltransferases contribute to homologous recombination by transcriptionally activating the BRCA1 and RAD51 genes. _PLoS ONE_ 7, e52810 (2012). Article  ADS  CAS  PubMed  PubMed Central 

Google Scholar  * Schiltz, R. L. et al. Overlapping but distinct patterns of histone acetylation by the human coactivators p300 and PCAF within nucleosomal substrates. _J. Biol. Chem._ 274,

1189–1192 (1999). Article  CAS  PubMed  Google Scholar  * Vempati, R. K. et al. p300-mediated acetylation of histone H3 lysine 56 functions in DNA damage response in mammals. _J. Biol.

Chem._ 285, 28553–28564 (2010). Article  CAS  PubMed  PubMed Central  Google Scholar  * Pankotai, T., Bonhomme, C., Chen, D. & Soutoglou, E. DNAPKcs-dependent arrest of RNA polymerase II

transcription in the presence of DNA breaks. _Nat. Struct. Mol. Biol._ 19, 276–282 (2012). Article  CAS  PubMed  Google Scholar  * Picaud, S. et al. Generation of a selective small molecule

inhibitor of the CBP/p300 bromodomain for leukemia therapy. _Cancer Res._ 75, 5106–5119 (2015). Article  CAS  PubMed  PubMed Central  Google Scholar  * Moroni, M. C. et al. Apaf-1 is a

transcriptional target for E2F and p53. _Nat. Cell Biol._ 3, 552–558 (2001). Article  CAS  PubMed  Google Scholar  * Nahle, Z. et al. Direct coupling of the cell cycle and cell death

machinery by E2F. _Nat. Cell Biol._ 4, 859–864 (2002). Article  CAS  PubMed  Google Scholar  * Murr, R. et al. Histone acetylation by Trrap-Tip60 modulates loading of repair proteins and

repair of DNA double-strand breaks. _Nat. Cell Biol._ 8, 91–99 (2006). Article  CAS  PubMed  Google Scholar  * Sun, Y. et al. Histone H3 methylation links DNA damage detection to activation

of the tumour suppressor Tip60. _Nat. Cell Biol._ 11, 1376–1382 (2009). Article  CAS  PubMed  PubMed Central  Google Scholar  * Xu, Y. et al. The p400 ATPase regulates nucleosome stability

and chromatin ubiquitination during DNA repair. _J. Cell. Biol._ 191, 31–43 (2010). Article  CAS  PubMed  PubMed Central  Google Scholar  * Sobczak, M., Pitt, A. R., Spickett, C. M.,

Robaszkiewicz, A. PARP1 co-regulates EP300–BRG1-dependent transcription of genes involved in breast cancer cell proliferation and DNA repair. _Cancers_ 11, E1539 (2019). * Lee, J. H. &

Paull, T. T. ATM activation by DNA double-strand breaks through the Mre11-Rad50-Nbs1 complex. _Science_ 308, 551–554 (2005). Article  ADS  CAS  PubMed  Google Scholar  * Lee, J. H. et al.

Distinct functions of Nijmegen breakage syndrome in ataxia telangiectasia mutated-dependent responses to DNA damage. _Mol. Cancer Res._ 1, 674–681 (2003). CAS  PubMed  Google Scholar  *

Uziel, T. et al. Requirement of the MRN complex for ATM activation by DNA damage. _EMBO J._ 22, 5612–5621 (2003). Article  CAS  PubMed  PubMed Central  Google Scholar  * Bakkenist, C. J.

& Kastan, M. B. DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. _Nature_ 421, 499–506 (2003). Article  ADS  CAS  PubMed  Google Scholar  *

Nakad, R. & Schumacher, B. DNA damage response and immune defense: links and mechanisms. _Front. Genet._ 7, 147 (2016). Article  PubMed  PubMed Central  Google Scholar  * Chailleux, C.

et al. Physical interaction between the histone acetyl transferase Tip60 and the DNA double-strand breaks sensor MRN complex. _Biochem. J._ 426, 365–371 (2010). Article  CAS  PubMed  Google

Scholar  * Fry, C. J. et al. Activation of the murine dihydrofolate reductase promoter by E2F1. A requirement for CBP recruitment. _J. Biol. Chem._ 274, 15883–15891 (1999). Article  CAS 

PubMed  Google Scholar  * Lang, S. E., McMahon, S. B., Cole, M. D. & Hearing, P. E2F transcriptional activation requires TRRAP and GCN5 cofactors. _J. Biol. Chem._ 276, 32627–32634

(2001). Article  CAS  PubMed  Google Scholar  * Swarnalatha, M., Singh, A. K. & Kumar, V. Promoter occupancy of MLL1 histone methyltransferase seems to specify the proliferative and

apoptotic functions of E2F1 in a tumour microenvironment. _J. Cell. Sci._ 126, 4636–4646 (2013). Article  CAS  PubMed  Google Scholar  * Taubert, S. et al. E2F-dependent histone acetylation

and recruitment of the Tip60 acetyltransferase complex to chromatin in late G1. _Mol. Cell. Biol._ 24, 4546–4556 (2004). Article  CAS  PubMed  PubMed Central  Google Scholar  * Smerdon, M.

J., Lan, S. Y., Calza, R. E. & Reeves, R. Sodium butyrate stimulates DNA repair in UV-irradiated normal and _Xeroderma pigmentosum_ human fibroblasts. _J. Biol. Chem._ 257, 13441–13447

(1982). CAS  PubMed  Google Scholar  * Smerdon, M. J. & Lieberman, M. W. Nucleosome rearrangement in human chromatin during UV-induced DNA- repair synthesis. _Proc. Natl Acad. Sci. USA_

75, 4238–4241 (1978). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  * Guo, R., Chen, J., Mitchell, D. L. & Johnson, D. G. GCN5 and E2F1 stimulate nucleotide excision repair

by promoting H3K9 acetylation at sites of damage. _Nucleic Acids Res._ 39, 1390–1397 (2011). Article  CAS  PubMed  Google Scholar  * Bakkenist, C. J. & Kastan, M. B. Chromatin

perturbations during the DNA damage response in higher eukaryotes. _DNA Repair (Amst.)_ 36, 8–12 (2015). Article  CAS  Google Scholar  * Gursoy-Yuzugullu, O., House, N. & Price, B. D.

Patching broken DNA: nucleosome dynamics and the repair of DNA breaks. _J. Mol. Biol._ 428, 1846–1860 (2016). Article  CAS  PubMed  Google Scholar  * Ayoub, N., Jeyasekharan, A. D., Bernal,

J. A. & Venkitaraman, A. R. HP1-beta mobilization promotes chromatin changes that initiate the DNA damage response. _Nature_ 453, 682–686 (2008). Article  ADS  CAS  PubMed  Google

Scholar  * Ayrapetov, M. K., Gursoy-Yuzugullu, O., Xu, C., Xu, Y. & Price, B. D. DNA double-strand breaks promote methylation of histone H3 on lysine 9 and transient formation of

repressive chromatin. _Proc. Natl Acad. Sci. USA_ 111, 9169–9174 (2014). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  * Baldeyron, C., Soria, G., Roche, D., Cook, A. J. &

Almouzni, G. HP1alpha recruitment to DNA damage by p150CAF-1 promotes homologous recombination repair. _J. Cell. Biol._ 193, 81–95 (2011). Article  CAS  PubMed  PubMed Central  Google

Scholar  * Chou, D. M. et al. A chromatin localization screen reveals poly (ADP ribose)-regulated recruitment of the repressive polycomb and NuRD complexes to sites of DNA damage. _Proc.

Natl Acad. Sci. USA_ 107, 18475–18480 (2010). Article  ADS  PubMed  PubMed Central  Google Scholar  * Goodarzi, A. A. et al. ATM signaling facilitates repair of DNA double-strand breaks

associated with heterochromatin. _Mol. Cell_ 31, 167–177 (2008). Article  CAS  PubMed  Google Scholar  * Moyal, L. et al. Requirement of ATM-dependent monoubiquitylation of histone H2B for

timely repair of DNA double-strand breaks. _Mol. Cell_ 41, 529–542 (2011). Article  CAS  PubMed  PubMed Central  Google Scholar  * Ziv, Y. et al. Chromatin relaxation in response to DNA

double-strand breaks is modulated by a novel ATM- and KAP-1 dependent pathway. _Nat. Cell Biol._ 8, 870–876 (2006). Article  CAS  PubMed  Google Scholar  * Goldstein, M., Derheimer, F. A.,

Tait-Mulder, J. & Kastan, M. B. Nucleolin mediates nucleosome disruption critical for DNA double-strand break repair. _Proc. Natl Acad. Sci. USA_ 110, 16874–16879 (2013). Article  ADS 

CAS  PubMed  PubMed Central  Google Scholar  * Coschi, C. H. et al. Haploinsufficiency of an RB-E2F1-Condensin II complex leads to aberrant replication and aneuploidy. _Cancer Discov._ 4,

840–853 (2014). Article  CAS  PubMed  Google Scholar  * Coschi, C. H. et al. Mitotic chromosome condensation mediated by the retinoblastoma protein is tumor-suppressive. _Genes Dev._ 24,

1351–1363 (2010). Article  CAS  PubMed  PubMed Central  Google Scholar  * Ishak, C. A. et al. An RB-EZH2 complex mediates silencing of repetitive DNA sequences. _Mol. Cell_ 64, 1074–1087

(2016). Article  CAS  PubMed  PubMed Central  Google Scholar  * Velez-Cruz, R. & Johnson, D. G. The retinoblastoma (RB) tumor suppressor: pushing back against genome instability on

multiple fronts. _Int. J. Mol. Sci_. 18, E1776 (2017). * Biedermann, S. et al. The retinoblastoma homolog RBR1 mediates localization of the repair protein RAD51 to DNA lesions in

Arabidopsis. _EMBO J._ 36, 1279–1297 (2017). Article  CAS  PubMed  PubMed Central  Google Scholar  * Horvath, B. M. et al. Arabidopsis RETINOBLASTOMA RELATED directly regulates DNA damage

responses through functions beyond cell cycle control. _EMBO J._ 36, 1261–1278 (2017). Article  CAS  PubMed  PubMed Central  Google Scholar  * Xie, A., Kwok, A. & Scully, R. Role of

mammalian Mre11 in classical and alternative nonhomologous end joining. _Nat. Struct. Mol. Biol._ 16, 814–818 (2009). Article  CAS  PubMed  PubMed Central  Google Scholar  * Ikura, M. et al.

Acetylation of histone H2AX at Lys 5 by the TIP60 histone acetyltransferase complex is essential for the dynamic binding of NBS1 to damaged chromatin. _Mol. Cell. Biol._ 35, 4147–4157

(2015). Article  CAS  PubMed  PubMed Central  Google Scholar  * Maser, R. S. et al. Mre11 complex and DNA replication: linkage to E2F and sites of DNA synthesis. _Mol. Cell. Biol._ 21,

6006–6016 (2001). Article  CAS  PubMed  PubMed Central  Google Scholar  * Kim, J. et al. Tudor, MBT and chromo domains gauge the degree of lysine methylation. _EMBO Rep._ 7, 397–403 (2006).

CAS  PubMed  PubMed Central  Google Scholar  * Yang, Y. et al. TDRD3 is an effector molecule for arginine-methylated histone marks. _Mol. Cell_ 40, 1016–1023 (2010). Article  CAS  PubMed 

PubMed Central  Google Scholar  * Klein, B. J. et al. The histone-H3K4-specific demethylase KDM5B binds to its substrate and product through distinct PHD fingers. _Cell Rep._ 6, 325–335

(2014). Article  CAS  PubMed  PubMed Central  Google Scholar  Download references ACKNOWLEDGEMENTS We thank B. Brooks and R. Deen for manuscript preparation; J. Holcomb for graphics; J.

Orona and M. Portis for expert technical assistance; Ray. S for preliminary study; Lin. K for biostatistics; C. Sagum and the Protein Array and Analysis Core (supported by CPRIT RP180804)

and J. Terpstra and C. Jeter of the Flow Cytometry & Cellular Imaging Core (supported by CPRIT RP170628) for assistance with IF; JJ Shen and the Next-Generation Sequencing Core

(supported by CPRIT RP120348 and RP170002) for RNA-Seq; A. Multani and the Molecular Cytogenetics Facility for metaphase spreads analysis; D. Hollowell and the Transgenic Animal Core for

generating knock-in mice; C. Perez of the Research Histology, Pathology and Imaging services for IHC; and Dale Weiss and colleagues in the Research Animal Support Facility for animal care.

This work was supported by grants from the Cancer Prevention and Research Institute of Texas (RP140222 to D.G.J.); the National Institutes of Health (CA214723 to D.G.J., GM100907 to T.G.K.

and Cancer Core Support Grant CA016672); and institutional funding from the Department of Epigenetics and Molecular Carcinogenesis, the Center for Cancer Epigenetics, and the Center for

Genetics and Genomics. AUTHOR INFORMATION Author notes * Renier Vélez-Cruz Present address: Department of Biochemistry, Midwestern University, Chicago College of Osteopathic Medicine,

Downers Grove, IL, 60515, USA * Anup K. Biswas Present address: Herbert Irving Comprehensive Cancer Center, Columbia University, New York, NY, 10032, USA AUTHORS AND AFFILIATIONS *

Department of Epigenetics and Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Science Park, Smithville, TX, 78957, USA Swarnalatha Manickavinayaham, Renier

Vélez-Cruz, Anup K. Biswas, Ella Bedford, Bin Liu, Mark T. Bedford & David G. Johnson * Department of Pharmacology, University of Colorado School of Medicine, Aurora, CO, 80045, USA

Brianna J. Klein & Tatiana G. Kutateladze Authors * Swarnalatha Manickavinayaham View author publications You can also search for this author inPubMed Google Scholar * Renier Vélez-Cruz

View author publications You can also search for this author inPubMed Google Scholar * Anup K. Biswas View author publications You can also search for this author inPubMed Google Scholar *

Ella Bedford View author publications You can also search for this author inPubMed Google Scholar * Brianna J. Klein View author publications You can also search for this author inPubMed 

Google Scholar * Tatiana G. Kutateladze View author publications You can also search for this author inPubMed Google Scholar * Bin Liu View author publications You can also search for this

author inPubMed Google Scholar * Mark T. Bedford View author publications You can also search for this author inPubMed Google Scholar * David G. Johnson View author publications You can also

search for this author inPubMed Google Scholar CONTRIBUTIONS Conceptualization: S.M., R.V.-C., and D.G.J.; methodology: S.M., R.V.-C., A.K.B., M.T.B., and T.G.K.; investigation: S.M.,

R.V.-C., E.B., and B.J.K.; formal analysis: B.L.; writing—original draft: S.M. and D.G.J., writing—review and editing: R.V.-C., A.K.B., M.T.B., and T.G.K.; funding acquisition: M.T.B.,

T.G.K., and D.G.J., supervision: M.T.B., T.G.K., and D.G.J. CORRESPONDING AUTHOR Correspondence to David G. Johnson. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing

interests. ADDITIONAL INFORMATION PEER REVIEW INFORMATION _Nature Communications_ thanks Stefano Campaner and the other, anonymous, reviewer(s) for their contribution to the peer review of

this work. Peer reviewer reports are available. PUBLISHER’S NOTE Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION PEER REVIEW FILE REPORTING SUMMARY DESCRIPTION OF ADDITIONAL SUPPLEMENTARY FILES SUPPLEMENTARY DATA 1 SUPPLEMENTARY DATA 2 SUPPLEMENTARY

DATA 3 SUPPLEMENTARY DATA 4 SUPPLEMENTARY DATA 5 SOURCE DATA SOURCE DATA RIGHTS AND PERMISSIONS OPEN ACCESS This article is licensed under a Creative Commons Attribution 4.0 International

License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source,

provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons

license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by

statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit

http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Manickavinayaham, S., Vélez-Cruz, R., Biswas, A.K. _et al._ E2F1 acetylation

directs p300/CBP-mediated histone acetylation at DNA double-strand breaks to facilitate repair. _Nat Commun_ 10, 4951 (2019). https://doi.org/10.1038/s41467-019-12861-8 Download citation *

Received: 04 April 2019 * Accepted: 03 October 2019 * Published: 30 October 2019 * DOI: https://doi.org/10.1038/s41467-019-12861-8 SHARE THIS ARTICLE Anyone you share the following link with

will be able to read this content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt

content-sharing initiative