ABSTRACT The emergence of antimicrobial-resistant bacteria is an increasingly serious threat to global health, necessitating the development of innovative antimicrobials. Here we report the

development of a series of CRISPR-Cas13a-based antibacterial nucleocapsids, termed CapsidCas13a(s), capable of sequence-specific killing of carbapenem-resistant _Escherichia coli_ and

methicillin-resistant _Staphylococcus aureus_ by recognizing corresponding antimicrobial resistance genes. CapsidCas13a constructs are generated by packaging programmed CRISPR-Cas13a into a

bacteriophage capsid to target antimicrobial resistance genes. Contrary to Cas9-based antimicrobials that lack bacterial killing capacity when the target genes are located on a plasmid, the

CapsidCas13a(s) as both therapeutic agents against antimicrobial-resistant bacteria and nonchemical agents for detection of bacterial genes. SIMILAR CONTENT BEING VIEWED BY OTHERS

PHAGEMID-BASED CAPSID SYSTEM FOR CRISPR-CAS13A ANTIMICROBIALS TARGETING METHICILLIN-RESISTANT _STAPHYLOCOCCUS AUREUS_ Article Open access 13 September 2024 EFFICIENT SYNTHESIS OF

CRISPR-CAS13A-ANTIMICROBIAL CAPSIDS AGAINST MRSA FACILITATED BY SILENT MUTATION INCORPORATION Article Open access 13 July 2024 BACTERIAL RESISTANCE TO CRISPR-CAS ANTIMICROBIALS Article Open

access 26 August 2021 INTRODUCTION The emergence and spread of antimicrobial resistance among pathogenic bacteria has been a growing global public health concern for several decades1.

According to the recent CDC’s report on antimicrobial resistance, >2.8 million antimicrobial-resistant infections occur in the U.S. each year, and >35,000 people die as a result2. It

is also predicted that antimicrobial-resistant (AMR) pathogens will cause 10 million fatalities per year by 2050 if new antimicrobial strategies are not developed3. In fact, the emergence of

AMR bacteria has led to the post-antibiotic era, in which many currently available antimicrobials are no longer effective. This is due in part to the decline in antibiotic innovation, as no

new class of antibiotics has been developed against Gram-negative bacteria in >45 years, and only a limited number of antibiotics were in either phase II or III clinical trials4.

Therefore, there is an urgent need for new strategies to develop alternative therapeutic approaches to prevent infections of AMR bacteria. To this end, various nucleic acid-based

antibacterials, peptides, bacteriophage therapies, antibodies, bacteriocins, and anti-virulence compounds have been recently developed5. Among these, CRISPR (clustered regularly interspaced

short palindromic repeats)-Cas3- and Cas9-encoding phages provide a means to combat such threats by selectively killing AMR bacteria6. The CRISPR-Cas3 and CRISPR-Cas9 genome-editing

constructs, which were designed to target AMR genes, were delivered into bacteria by packaging them into phages7,8,9,10,11 to achieve AMR gene-specific bacterial killing7,8,9,10,11,12 and

prevent the spread of AMR genes7. However, because DNA cleavage of plasmid DNA does not result in bacterial death, at least not in the absence of other confounding variables, such as a

toxin–antitoxin system, this strategy is ineffective in targeting bacteria with plasmid-borne AMR genes9. CRISPR-Cas13a is a CRISPR-Cas type VI class 2 system and is characterized by

RNA-guided single-stranded RNA (ssRNA) cleavage activity13,14. A 2016 study by Abudayyeh et al. demonstrated that CRISPR-Cas13a has promiscuous ssRNA cleavage activities and restricts host

bacteria growth due to the degradation of the bacterial RNAs (ref. 14). This has turned out to be a defense system against phages15. When phages infect bacteria, CRISPR-Cas13a recognizes

transcript of phage genome, which leads to nonspecific degradation of bacterial transcripts and arrests bacterial cell growth to prevent the spread of infection. Recently, we identified four

different subtypes of CRISPR-Cas13a systems from 11 strains of six _Leptotrichia_ species16. Among them CRISPR-Cas13a form _Leptotrichia shahii_ (LshCas13a) had a significant inhibition

effect on bacterial growth, consistent with the observation by Abudayyeh et al.14. We here report success in developing sequence-specific antimicrobials by packaging the LshCas13a into

bacteriophage capsids, which can be used as both therapeutic agents against AMR bacterial infections and nonchemical agents to detect bacterial genes for diagnosis. RESULTS BACTERICIDAL

ACTIVITY OF CAS13A First, we verified the growth inhibition ability of CRISPR-Cas13a (LshCas13a) in comparison with CRISPR-Cas9 by using _Escherichia coli_ carrying the carbapenem resistance

gene _bla_IMP-1 on a chromosome or plasmid. To this end, we constructed two plasmids (pKLC21 and pKLC54) harboring CRISPR-Cas13a or CRISPR-Cas9 with spacers targeting _bla_IMP-1 (spacer

sequence was optimized, see later), and introduced them into the _E. coli_, respectively, to test their growth inhibition effect against the host cells carrying _bla_IMP-1 (Fig. 1a). As

expected, the LshCas13a with targeting _bla_IMP-1 decreased the number of bacteria by two to three orders of magnitude against the bacteria carrying _bla_IMP-1 both on chromosome (from 2.6 ×

 1010 to 2.0 × 108 CFU/ml) and plasmid (from 2.3 × 1010 to 8.7 × 106 CFU/ml). However the CRISPR-Cas9 decreased the number of bacteria by three orders of magnitude against the bacteria

carrying the _bla_IMP-1 only on the chromosome (from 6.3 × 1010 to 3.6 × 107 CFU/ml), but not on the plasmid (from 2.8 × 1010 to 2.2 × 1010 CFU/ml), when compared with their respective

nontargeting controls (Fig. 1b, c). These results agreed with the fact that while CRISPR-Cas9 caused cell death by double-strand DNA breaks, CRISPR-Cas13a induced cell dormancy by collateral

nonspecific cleavage of RNA (ref. 14). However, it is not clear whether the above decrements in cell number by Cas13a is due to cell death. In order to determine whether Cas13a causes cell

death or not, we have constructed a system in which CRISPR-Cas13a targeting mRNA of red fluorescent protein (RFP) transcribed from plasmid inhibits the growth of bacteria harboring RFP,

following the method by Abudayyeh et al.14. We carried out the experiment in broth culture medium using LshCas13a by introducing an anhydrotetracycline (aTc)-inducible RFP plasmid

(pKLC56-_rfp_), as well as an RFP-targeting LshCas13a (Cas13a__rfp_) into _E. coli_ (Fig. 1d), where the same spacer sequence used by Abudayyeh et al. was used to target _rfp_ (ref. 14). We

observed the similar cell growth restriction by LshCas13a upon induction of the target _rfp_ transcription compared to nontarget control and non-induction control (Fig. 1e, left and middle

panels). Interestingly, when the same experiment was carried out using _bla_IMP-1 as target gene, the bacteria growth curve stopped rising upon induction of _bla_IMP-1 transcription (Fig. 

1e, right panel), indicating cell growth might be completely stopped due to the cell death or dormancy. To make this point clear, viable cells carrying _bla_IMP-1-targeting spacer were

counted during the culture with and without aTc induction of _bla_IMP-1 transcription. As seen in Fig. 1f, the number of viable cells were decreased by about three orders of magnitude from

5.5 × 106 to 8.8 × 103 during the 8 h upon induction of _bla_IMP-1 transcription. We interpreted these results as demonstration of CRISPR-Cas13a-mediated sequence-specific killing of host

cells. However, reasons of the viable cells that are in dormancy15 or resistant to CRISPR-Cas13a are not clear at the moment, but we did not find any mutation in target sequence after

sequencing 32 randomly selected colonies from the above two experiments (Fig. 1b). We also observed that the induction of _bla_IMP-1 transcription inhibited the host cell growth (Fig. 1e,

right panel), which could be attributed to fitness cost of _bla_IMP-1 overexpression. It is well known that the accumulation of carbapenemase compromises the bacterial growth17,18. PACKAGING

OF CRISPR-CAS13A INTO BACTERIOPHAGE CAPSID Having verified the bactericidal activity of the CRISPR-Cas13a__bla_IMP-1 construct against _bla_IMP-1-positive bacteria, we came up with the idea

 that AMR bacteria-specific CapsidCas13a constructs could be synthesized by loading the CRISPR-Cas13a system into a phage capsid. The CRISPR-Cas13a__bla_IMP-1 was loaded into _E. coli_ phage

M13 capsid, to generate EC-CapsidCas13a__bla_IMP-1 (Fig. 2a), which demonstrated sequence-specific killing activity against bacteria carrying the _bla_IMP-1 gene in an

EC-CapsidCas13a__bla_IMP-1 concentration-dependent manner (Fig. 2b). Subsequently, we confirmed the same sequence-specific killing activities with a series of CapsidCas13a constructs

programmed to target different genotypes of carbapenem-resistant genes (_bla_IMP-1, _bla_OXA-48, _bla_VIM-2, _bla_NDM-1, and _bla_KPC-2) and colistin-resistant genes (_mcr_-1 and _mcr_-2),

all of which are currently a problem in the clinical setting (Fig. 2c, Supplementary Fig. 1). Conversely, nontargeting CapsidCas13a (with nontargeting spacer) killed no bacteria under any

circumstance, indicating that this construct has robust specificity for gene-directed antimicrobial therapy against AMR bacterial infections. In order to compare the characteristics of

CapsidCas13a with previously reported Cas9-based antimicrobial agents, we generated a Cas9-based EC-CapsidCas9__bla_NDM-1 construct with the same protocol, but in this instance

CRISPR-Cas13a__bla_NDM-1 was replaced with CRISPR-Cas9__bla_NDM-1 and its bactericidal manner was compared with that of EC-CapsidCas13a__bla_NDM-1. As expected, EC-CapsidCas9__bla_NDM-1

killed only the bacteria with a chromosomal target gene, while EC-CapsidCas13a__bla_NDM-1 killed the bacteria that carried the target gene on either the chromosome or plasmid (Fig. 2d).

Since many clinically important AMR genes, including carbapenem-resistant genes found in Enterobacteriaceae are encoded on plasmids19,20, CapsidCas13a was expected to be superior to

CapsidCas9 in light of the killing efficiency. Besides, previous studies have suggested that CRISPR-Cas9 is prone to unexpected genetic mutations due to its DNA cleavage activity21,22,23. On

the contrary, instead of the direct cleavage of DNA, CapsidCas13a targets bacterial mRNA. Therefore, unexpected genetic mutations of the bacteria are less likely to occur due to the action

of Cas13a. Although an intensive study is needed, at least, as mentioned above we did not find any mutation in target genes by sequencing 32 Cas13a-resistant colonies. These characteristics

showed a different potential of Cas13a as an antimicrobial agent compared with Cas9. In order to determine whether the CapsidCas13a(s) can selectively kill target bacteria among a mixed

population of AMR bacteria, an artificial mixture of _E. coli_ NEB5α F′_I__q_ expressing the plasmid-borne carbapenem resistance gene _bla_IMP-1, the colistin resistance gene _mcr-2_, or

with no resistance gene as a control, was treated with single-dose of each gene-specific EC-CapsidCas13a construct (i.e., EC-CapsidCas13a__bla_IMP-1 for targeting _bla_IMP-1, and

EC-CapsidCas13a__mcr-2_ for targeting _mcr-2_). Subsequently, the abundance of each bacterial strain was determined. As shown in Fig. 3, the percentage of cell numbers of NEB5α F′_I__q_

(_bla_IMP-1) and NEB5α F′_I__q_ (_mcr-2_) decreased significantly from 30.5% and 35.0% to 3.5% and 1.9%, respectively when the cell mixtures were treated with EC-CapsidCas13a__bla_IMP-1 and

EC-CapsidCas13a__mcr-2_, respectively. Meanwhile there was no change in the abundance of cell populations after being treated by EC-CapsidCas13a with nontargeting spacer control. These

sequence-specific killing activities of CapsidCas13a(s) demonstrate their potential as microbial control agents that can modify or manipulate the bacterial flora without affecting undesired

bacterial populations by killing those with specific genomic contents. Besides demonstrating of the versatility of CapsidCas13a, we investigated its in vivo therapeutic efficacy using a

_Galleria mellonella_ larvae infection model. Administration of EC-CapsidCas13a__bla_IMP-1 to _G. mellonella_ larvae infected with _E. coli_ R10-61 expressing _bla_IMP-1 showed significantly

improved survival over no treatment (_p_ = 0.0016) or a CapsidCas13a carrying nontargeting spacer, as a control (_p_ = 0.044) (Fig. 4). This outcome further strengthened the therapeutic

prospects of the CapsidCas13a constructs for treatment of infections with AMR bacteria. APPLICATION TO BACTERIAL GENE DETECTION Because the prevalence of stealth bacteria (carrying AMR genes

but not identifiable by existing antibiotic susceptibility tests) has been increasing24, a simple and easy-to-use detection method for such strains is required in the clinical setting. To

this end, the CapsidCas13a constructs were modified for the detection of bacterial AMR genes. First, the spacer sequence of EC-CapsidCas13a__bla_IMP-1 targeting the _bla_IMP-1 gene was

optimized in order to improve the killing efficiency. The optimization started with the construction of a CRISPR-Cas13a expression plasmid library, in which 121 spacer sequences targeting

different positions throughout the whole _bla_IMP-1 were inserted, each as one, into the CRISPR array. Then, all plasmids were individually transformed into _bla_IMP-1-expressing _E. coli_

cells and the resulting transformants were analyzed to identify the most effective spacer sequence (Supplementary Fig. 2a). The calculation of the number of spacer reads after deep

sequencing of the total plasmid DNAs extracted from the transformants found that all of the tested spacer sequences mediated target-specific bacterial killing, at least to some extent, when

judged by the depletion rate of the plasmid DNAs (Supplementary Fig. 2b). The depletion rate was calculated by normalizing the number of reads from cells expressing _bla_IMP-1 with that of

non-_bla_IMP-1--expression. Among these, 13 spacer sequences had depletion rates of >99.0 (Supplementary Fig. 2c). The _bla_IMP-1_563 spacer sequence GACTTTGGCCAAGCTTCTATATTTGCGT, which

had the highest depletion rate of 99.7, was chosen as the best spacer sequence for use in subsequent experiments (Supplementary Fig. 2c, Supplementary Table 4). Then, the carrier M13 phage

was replaced with the lysogenic phage Φ80 for use with the phage-inducible chromosomal island (PICI) packaging system (Supplementary Fig. 3)25,26, which is more flexible in genome

manipulation. Finally, the kanamycin (Km) resistance gene (KanR) was inserted as a selection marker to generate the constructs of PICI-based EC-CapsidCas13a::KanR__bla_IMP-1 and

EC-CapsidCas13a::KanR_nontargeting as a nontargeting spacer control (Fig. 5a). Next, we tested the detection efficiency of the constructs for _bla_IMP-1 by spotting 2 µL of tenfold serial

dilutions of EC-CapsidCas13a::KanR__bla_IMP-1 and EC-CapsidCas13a::KanR_nontargeting onto fresh top agar lawns of the test strains in Luria-Bertani (LB) agar with or without supplementation

of Km (Fig. 5b). To improve the efficiency, we opted to determine the bacterial killing effect against Km-resistant cells on Km plates (Fig. 5c), rather than assessing the bacterial killing

effect against original cells on Km-free plates (Fig. 5d). When the EC-CapsidCas13a::KanR__bla_IMP-1 carrying the Km resistance gene was applied on the soft agar bacterial lawn grown on

bottom agar containing Km, the cells infected by this capsid acquired Km resistance and, hence, could grow in the presence of Km. Nevertheless, with the bacterial cells carrying the target

AMR gene _bla_IMP-1, there was no observable growth due to the bactericidal effect of the CRISPR-Cas13a construct (Fig. 5c). This method was shown to be almost three orders of magnitude more

sensitive than direct observation of the bacterial growth inhibition on Km-free plates (Fig. 5d). We further confirmed the efficiency of this system, with the use of the M13 capsid-based

EC-CapsidM13Cas13a::KanR__bla_IMP-1 construct (Supplementary Fig. 4a–c). A subsequent experiment showed that the target AMR genes of interest located on either the plasmid or chromosome

could be precisely detected (Fig. 5e, f, Supplementary Fig. 4d, e), as expected, whereas CRISPR-Cas9 construct could detect only the genes located on a chromosome but not on a plasmid (Fig. 

5g). The detection ability was further confirmed with the CapsidCas13a constructs targeting other AMR genes _bla_OXA-48 and _bla_VIM-2 (Fig. 5e, f), toxin genes _stx_1 and _stx_2 (Fig. 5h),

and two genes (_bla_IMP-1 and _mcr-2_) located on the same plasmid (Fig. 5i), indicating that this method is applicable for the detection of any bacterial genes regardless of their location

on bacterial chromosome or plasmid. Although the sensitivity was slightly lower, it was even possible to detect target genes by directly spotting the CapsidCas13a(s) onto the bacteria

swabbed on an agar plate instead of using the soft agar overlay method (Supplementary Fig. 5). We also tried to apply the CapsidCas13a constructs to detect carbapenem-resistant clinical

isolates of _E. coli_ carrying _bla_IMP-1 or _bla_NDM-1. As these strains were not susceptible to Km, the KanR of EC-CapsidCas13a::KanR was replaced with the hygromycin (Hygro) resistance

gene, HygroR, to generate the constructs EC-CapsidCas13a::HygroR__bla_IMP-1 and EC-CapsidCas13a::HygroR__bla_NDM-1. The test results with these two CapsidCas13a(s) showed that the _E. coli_

clinical isolates carrying _bla_IMP-1 and _bla_NDM-1 were precisely detected, which was consistent with the results of polymerase chain reaction (PCR) analysis (Fig. 5j, Supplementary Fig. 

5d), suggesting that the CapsidCas13a(s) can be applied to detect bacterial genes. With regard to the application potential of CRISPR-Cas13a, our data demonstrated above has opened up a new

field in which it can be developed not only as an antibacterial therapeutic agent, but also as a new bacterial identification system where no nucleic acid manipulation is necessary once the

CapsidCas13a(s) are established. There was an elegant report on the CRISPR-Cas13-based nucleic acid detection method, called as SHERLOCK system, which was developed by combination of nucleic

acid amplification technique and CRISPR-Cas13. This method can detect DNA or RNA in vitro with attomolar level sensitivity27. In contrast, the proposed detection system using the

CapsidCas13a constructs can be performed without amplification of DNA or RNA, electrophoresis equipment or optical devices, as only bacterial culture plates are required. In addition,

>1010 transducing forming units (TFU) of CapsidCas13a constructs can be harvested per liter of host bacterial culture, and only 2–3 µL of 105 constructs per mL of solution is required for

a single spot test to accurately determine the presence or absence of target genes. Although these features highlight the elegant potential of CapsidCas13a(s) for bacterial gene detection,

there are still limitations, at least: (1) it is necessary to construct corresponding CapsidCas13a for each bacterial species and gene, (2) turnaround time for test results can be long since

interpretation of the results is dependent on bacterial growth, (3) it cannot be used when the bacteria cannot be cultured or the target gene is not transcribed. _STAPHYLOCOCCUS AUREUS_

CAPSIDCAS13A Lastly, in addition to demonstrating the bactericidal activity of CRISPR-Cas13a against Gram-negative bacteria, we also attempted to confirm the collateral activity of

CRISPR-Cas13a against Gram-positive bacteria using _Staphylococcus aureus_. First, a set of _E. coli–S. aureus_ shuttle vectors, namely pKLC4(s), were generated carrying the CRISPR-Cas13a

construct with or without a spacer sequence targeting the _S_. _aureus rpsE_ genes. Transformation of the vector into _S. aureus_ strain RN4220 showed that the bactericidal activity of

CRISPR-Cas13a with an appropriate spacer sequence was similar to that in _E. coli_ (Supplementary Fig. 6a). Then, a SA-CapsidCas13a__mecA_ construct was produced to target

methicillin-resistant gene _mecA_ of methicillin-resistant _S. aureus_ (MRSA), one of the most prevalent AMR pathogens worldwide28. We optimized the spacer sequences (Supplementary Fig. 

6b–e) and the CRISPR-Cas13a__mecA_-carrying vector (pKLC-SP__mecA_) construction were carried out in the same way as above for CRISPR-Cas13a__bla_IMP-1. The packing of CRISPR-Cas13a__mecA_

into _S. aureus_ phage 80α capsid was performed in accordance with the method established by Ubeda et al. using the _S. aureus_ pathogenicity island (SaPI) system29,30 (Supplementary Fig. 

7). This packing system simultaneously imparted tetracycline (Tet) resistance to the resulting SA-CapsidCas13a::TetR__mecA_ construct, since the SaPI carried the Tet resistance gene, which

made it possible to be tested for both bactericidal ability against MRSA and capability of MRSA detection by targeting _mecA_. As expected, when the methicillin-susceptible _S. aureus_

strain RN4220 and MRSA USA300 or _mecA_ knockout USA300 (USA300-Δ_mecA_) were infected with SA-CapsidCas13a__mecA_, the growth of only the USA300 strain carrying _mecA_ was significantly

inhibited (Fig. 5k, Supplementary Fig. 8), clearly demonstrating the sequence-specific bacterial killing ability of CRISPR-Cas13a against the Gram-positive bacteria _S. aureus_. DISCUSSION

In this study, we employed the promiscuous RNA cleavage ability of CRISPR-Cas13a via recognition of target RNA by CRISPR-RNA (crRNA), which resulted in host cell death, to generate a new

type of sequence-specific bacterial antimicrobials. To deliver the CRISPR-Cas13a to target bacteria, we packaged the CRISPR-Cas13a into carrier phage capsid using the PICI packaging system

for _E. coli_, and SaPI packaging system for _S. aureus_. Since synthesized CapsidCas13a does not carry phage genome, it thus belongs to the category of a nucleic acid drug or gene drug, not

an organism, thereby easily being put into practical use as a therapeutic drug. Although there are still many questions to be answered concerning practical application—such as host range of

the phage capsids, catalytic mode of Cas13a (refs. 14,15), the efficiency of phage capsid packaging, and ethical issues regarding genetic recombinants, etc.—our strategy demonstrated that

the CapsidCas13a antimicrobials are promising to be developed for at least three application categories: (1) as promising antibacterial therapeutic agents targeting any bacterial gene,

including AMR genes, or selectively killing targeted toxin-producing bacteria, (2) as a simple and inexpensive bacterial gene detection system for bacterial identification and efficient

molecular epidemiological investigations without the need for the amplification of nucleic acids or optic devices, (3) as tools to manipulate the bacterial flora by targeting and eliminating

a specific bacterial population without disrupting other irrelevant bacterial populations. In conclusion, the proposed CRISPR-Cas13a-based antimicrobials are expected to have a great impact

in the field of antimicrobial resistance for infection control, as well as bacterial flora control. METHODS ETHICS DECLARATIONS Ethics approval for the use of invertebrates was given by

Jichi Medical University ethics committee. BACTERIAL STRAINS AND CULTURE CONDITIONS Bacterial strains used in this study are listed in Supplementary Table 1. Bacterial strains were grown at

37 °C in LB medium (BD Difco). Unless otherwise indicated, proper antibiotics were added to growth medium to the following final concentrations: 100 µg/mL for ampicillin (Amp), 30 µg/mL for

Km, 34 µg/mL for chloramphenicol (Cm), 4 µg/mL for colistin, and 200 µg/mL for Hygro. CRISPR-CAS13A AND CRISPR-CAS9 GENE TARGETING VECTORS The CRISPR-Cas13a expression vector (pC003), which

carries LshC2c2 locus on pACYC184, was kindly provided by Dr. Feng Zhang (Addgene plasmid # 79152; http://n2t.net/addgene: 79152; RRID: Addgene_79152)14. In order to generate an efficient

vector series carrying a CRISPR-Cas13a system targeting various genes, we conducted vector manipulations. First, a DNA fragment of _cas13a-cas1-cas2_ locus was amplified from _L. shahii_

strain JCM16776 (ref. 14), using a primer set of LsCas13a clo-f and LsCas13a clo-r (Supplementary Table 3), and another DNA fragment from the pC003 vector was amplified, using primers pC003

PCR-r and pC003 PCR-f. The two DNA fragments were then ligated with In-Fusion HD Cloning Kit (Takara Bio Inc., Japan) to generate pKLC5, which resulted in the replacement of

_cas13a-cas1-cas2_ locus of pC003 with that of JCM16776. Next, the _cas1-cas2_ locus was removed from the pKLC5, because Cas1/2 is not necessary for bactericidal activity of CRISPR-Cas13a.

This was achieved by performing PCR on the pKLC5 using a primer set of Cas1 Cas2 del SacI-f and Cas1 Cas2 del SacI-r, digesting the PCR fragment with SacI (Takara Bio Inc., Japan) and

ligating again with Ligation high ver. 2 (Toyobo Co., Ltd, Japan) to generate pKLC5 ΔCas1/2. Following this, in order to enable the pKLC5 ΔCas1/2 to be packaged into M13 phage capsid, f1

origin together with KanR were inserted as follows: the f1 origin and the KanR were amplified from pRC319, a gift from Timothy Lu (Addgene plasmid # 61272; http://n2t.net/addgene: 61272;

RRID: Addgene_61272)9, using a primer set of InF13 pRC319-f and InF13 pRC319-r, and another primer set of InF13 PCR SalI-f and InF13 PCR SmaI-r was used to amplify vector part from the pKLC5

ΔCas1/2 vector. The resulting two DNA fragments were then ligated with In-Fusion HD Cloning Kit to generate pKLC21 that carries complete CRISPR-Cas13a system, except for leaving the cloning

site empty for insertion of any appropriate spacer. The pKLC21 carries f1 origin of M13 phage thus is able to interact with M13 phage. Finally, a CRISPR-Cas13a system targeting

carbapenem-resistant gene _bla_IMP-1 was constructed on the pKLC21 vector as follows: briefly, 33 mer oligo DNAs (28 mer of spacer and 5 mer for inserting _Bsa_I cut site) of blaIMP-1_104-s

and blaIMP-1_104-as, corresponding to nucleotide positions of _bla_IMP-1 from no. 104 to no. 132, were synthesized and annealed in annealing buffer (10 mM Tris-HCl (pH 8.0), 50 mM NaCl, and

1 mM EDTA). After that, pKLC21 was treated with restriction enzyme _Bsa_I-HF, gel purified and subsequently ligated with the annealed oligo DNA using Ligation high ver. 2 to obtain

pKLC21__bla_IMP-1_104. Likewise, a series of pKLC21 vectors targeting other carbapenem-resistant genes (_bla_NDM-1, _bla_KPC-2, _bla_OXA-48, and _bla__VIM-2_), colistin-resistant genes

(_mcr_-1 and _mcr_-2), and _mecA_, _rpsE_, and _ermC_ of _S. aureus_ were produced. The _bla_IMP-1-targeting pKLC21 vector library covering the whole sequences of _bla_IMP-1 was also

constructed in the same manner, whereby 121 different oligo DNAs pairs covering the whole _bla_IMP-1 were inserted into the _Bsa_I site of pKLC21. The sequences of all oligo DNAs used were

listed in the Supplementary Table 3. Apart from pKLC21 vector series, _S. aureus_–_E. coli_ shuttle vector carrying CRISPR-Cas13a (pKLC3.0) was also constructed. For the assembly of pKLC3.0,

three DNA segments, KanR (_aphA-3_) and ori of _E. coli_, _cat_ and p15A ori of _S. aureus_, and _cas13a_ were amplified from pHel3-FLAG (ref. 31), pDB114 (kindly provided by Dr. Luciano

Marraffini)10 and pKLC21, respectively, using the following primer sets (Supplementary Table 3): InF 3.0 KanR-f and InF 3.0 KanR-r; InF 3.0 SArep_CAT-f and InF 3.0 SArep_CAT-r; and InF 3.0

p15A ori_Cas13-f and InF 3.0 p15A ori_Cas13-r. The resulting three fragments were ligated with In-Fusion HD Cloning Kit to generate pKLC3.0. For the PICImid (plasmid carrying the PICI

packaging system) construction, the _cos_N and _rppA_ genes (ref. 25), which are necessary for the packaging of the island EcCICFT073, were cloned. These were amplified with a primer set of

InFpi araCosPPi NotI1-f and InFpi araCosPPi NotI1-r. The resulting fragment was digested with NotI (Takara Bio Inc., Japan) and subsequently cloned into the NotI site of pKLC21 to generate

PICImid pKLC31. To construct CRISPR-Cas9 expression vector, pYS29 vector32 was digested by PstI. The fragment containing CRISPR-Cas9 was ligated with a PCR fragment of pKLC21 that was

amplified using a primer pair InF54 pKLC21 PCR-f and InF54 pKLC21 PCR-r to generate pKLC54. A spacer sequence against _bla_IMP-1 was inserted into the BsaI site of pKLC54 vector to obtain

pKLC54__bla_IMP-1_560 using Ligation high ver. 2. Oligo DNAs used for the spacer construction are listed in Supplementary Table 3. _S. AUREUS_–_E. COLI_ CRISPR-CAS13A__MECA_ SHUTTLE VECTOR

We constructed the vector pKLC-SP__mecA_ that carries CRISPR-Cas13a__mecA_ sequences flanked by two homologous recombination regions from _bap_ (encoding biofilm associated protein) of

staphylococcal SaPIbov2 on the _S. aureus_–_E. coli_ vector pIMAY. Two PCR fragments of 5′ and 3′ regions of _bap_ on SaPIbov2 were first amplified from _S. aureus_ strain

RN4220-80α-∆_terS_-SaPIbov2::tetM (refs. 29,33). The primers BAPup 7272-F and BAPup 8172-R were used for the PCR amplification of the 5′ region of _bap_ gene, while primers BAPdown 12224-F

and BAPdown 13089-R were used to amplify the 3′ region. The two fragments with 15-bp flanking sequences homologous to vector ends were then sequentially integrated into a

temperature-sensitive plasmid pIMAY, using In-Fusion HD Cloning Kit generating pIMAY-_bap_Up/Down. Meanwhile, we used pKLC21__mecA_-5 as a template for amplification of CRISPR-Cas13a__mecA_

with spacer targeting _mecA_ and a CRISPR-Cas13a system devoid of spacer targeting _mecA_ (CRISPR-Cas13a_nontargeting). The PCR amplification was carried out with primer pairs of LsC2c2

mecA5-F and LsC2c2 mecA5-R to obtain CRISPR-Cas13a__mecA_, and LsC2c2 mecA5-F and LsC2c2 188-R to obtain CRISPR-Cas13a_nontargeting (control). Finally, we individually inserted the PCR

products between the 5′ and 3′ region of _bap_ on pIMAY-_bap_Up/Down with In-Fusion HD Cloning Kit to generate pKLC-SP__mecA_ and pKLC-SP_null (control). CONSTRUCTION OF TARGET GENE

EXPRESSION VECTORS We constructed two plasmid systems for expression of target genes of the CRISPR-Cas13a systems: a pSP72 aTc-inducible vector in which the cloning site for target gene

expression was under the control of aTc; and pKLC26 that does not contain f1 origin of replication from M13 phage. For the construction of pSP72, aTc-regulatory element was first amplified

from pC008 vector using TetReg SalI-f and TetReg BamHI-r primers, and the amplicon was digested with restriction enzymes SalI and BamHI. After digestion, the fragment was inserted into the

SalI–BamHI site of pSP72 vector (Promega Corporation, US) carrying pBR322 origin. The resulting plasmid was termed as pSP72 aTc-inducible vector because the cloning site (BamHI/EcoRI) for

expression of target gene is regulated by aTc-inducible promoter. The pC008 (pBR322 with Tet-inducible RFP) was a gift from Feng Zhang (Addgene plasmid # 79157; http://n2t.net/addgene:

79157; RRID: Addgene_79157)14. A subsequent set of vectors expressing target genes for CRISPR-Cas13a was produced by cloning AMR genes (e.g., _bla_IMP-1, _bla_NDM-1, _bla_KPC-2, _bla_OXA-48,

and _bla_VIM-2) on the BamHI/EcoRI site of the generated plasmid. The pKLC26 was constructed by modifying pBAD33 with deletion of f1 origin and ARA-promoter. First, pBAD33 vector was

amplified with two primers, pBAD33 PCR XhoI-f and pBAD33 PCR XhoI-r, which were designed to exclude f1 origin. After digestion with restriction enzyme XhoI, the fragment was self-ligated

with Ligation high ver. 2 to generate pKLC23. Then, the pKLC23 vector and _bla_IMP-1 native promoter sequence (1,716-1,168 bp of GenBank ID: AB733642.1 artificially synthesized by GENEWIZ)

were independently amplified with two primer sets, pKLC23 PCR InFusion-f2 and pKLC23 PCR InFusion-r2, and InFusion-f and Intl1pro InFusion-r, respectively. Combination of the resulting two

fragments with In-Fusion HD Cloning Kit finally generated pKLC26 vector, which carries _bla_IMP-1 native promoter in replacement of ARA-promoter. To obtain pKLC26__bla_IMP-1 for _bla_IMP-1

expression, two PCR amplifications were carried out, generating a fragment of pKLC26 using a primer pair InF18 pKLC26-f and InF18 pKLC26-r, and a fragment of _bla_IMP-1 (GenBank ID: S71932)

using a primer pair InF18 IMP-1-f and InF18 IMP-1-r. The two DNA fragments were then ligated with In-Fusion HD Cloning Kit to yield pKLC26__bla_IMP-1. By using the same method, a series of

vectors for expression of the following AMR genes were generated (Supplementary Table 2): _bla_NDM-1 (GenBank ID: FN396876), _bla_KPC-2 (GenBank ID: AY034847), _bla_VIM-2 (GenBank ID:

AF191564), _bla_OXA-48 (GenBank ID: AY236073), _mcr_-1 (GenBank ID: KP347127), _mcr_-2 (GenBank ID: LT598652), _hygroR_ (the sequence was subcloned from TOPO HygroR that was a gift from

Tyler Jacks, Addgene plasmid # 68445), and _rfp_ (encoding RFP, GenBank ID: KJ021042). To yield pKLC26__bla_IMP-1__mcr_-2, two PCR amplifications were carried out, generating a fragment of

pKLC26__bla_IMP-1 using a primer pair InF55 pKLC26IMP1-f and InF55 pKLC26IMP1-r, and a fragment of pKLC26__mcr_-2 using a primer pair InF55 pKLC26mcr2-f and InF55 pKLC26mcr2-r. The two DNA

fragments were then ligated with In-Fusion HD Cloning Kit. We confirmed the expressions of cloned genes by susceptibility test against corresponding antibiotics using the disk diffusion test

recommended by CLSI. To obtain pKLC42 for _hygroR_ expression under the control of RecA promoter, PCR amplifications were carried out, generating a fragment of pKLC26_HygroR using a primer

pair InF42 HygroR-f and InF42 HygroR-r. The PCR fragment and synthesized RecA promoter oligo DNA (Supplementary Table 3) were then ligated with In-Fusion HD Cloning Kit. Construction of the

pKLC53 was carried out as follows. The RecA promoter was amplified from the pKLC42 using a primer set of InF53 pKLC42 PCR-r and InF53 pKLC42 PCR-f, and the IMP-1 expression sequence was

amplified from pKLC26_blaIMP-1, using primers of InF53 IMP-1 PCR-f and InF53 IMP-1 PCR-r. The two amplicons were then ligated with In-Fusion HD Cloning Kit to generate pKLC53. To obtain

pKLC56__bla_IMP-1 for _bla_IMP-1 expression under the control of Tet-inducible promoter, two PCR amplifications were carried out, generating a fragment of pKLC26__bla_IMP-1 using a primer

pair InF56 pKLC26_IMP-1-f and InF56 pKLC26_IMP-1-r, and a fragment of pSP72 aTc-inducible vector using a primer pair InF56 Tet-ind clo-f and InF56 Tet-ind clo-r. The two DNA fragments were

then ligated with In-Fusion HD Cloning Kit. By using the same method, aTc-inducible RFP vector and the control vector were generated (Supplementary Table 2). GENERATION OF M13 PHAGE-BASED

EC-CAPSIDM13CAS13A First, to prevent M13 phage genome from self-assembly, the f1 origin of replication of the helper phage M13KO7 (New England Biolabs, US) was deleted. This was achieved by

performing PCR on M13KO7 plasmid using primer pair of M13KO7 PCR InFusion-f and M13KO7 PCR InFusion-r, and subsequently ligating the resulting fragment with another PCR product carrying p15A

origin and Cm-resistant gene, which was amplified from pBAD33 using a primer pair of pBAD33 PCR InFusion-f and pBAD33 PCR InFusion-r. The ligation was performed with In-Fusion HD Cloning

Kit and the resulting phagemid was termed pKLC25. Next, CRISPR-Cas13a-loaded _E. coli_ M13 phage capsid targeting _bla_IMP-1 (M13 phage-based EC-CapsidM13Cas13a__bla_IMP-1) was generated as

follows: pKLC25 vector was transformed into _E. coli_ MC1061 to synthesize helper phage (phage capsid). The transformed bacteria were selected on Cm plates. Subsequently, the _E. coli_

harboring pKLC25 was transformed with pKLC21 that carries CRISPR-Cas13a and f1 origin of M13 (i.e., pKLC21__bla_IMP-1 vector), and selected on the LB agar containing Cm and Km. The colonies

grown on this double antibiotic selection plate were picked and cultured in LB liquid medium containing Cm and Km at 37 °C. _E. coli_ cultures at stationary phase were then centrifuged at

8000 × _g_ for 20 min and the supernatant was passed through a 0.22 µm filter. Equal volume of PEG buffer (5 mM Tris-HCl (pH 7.5), 10% PEG 6000, 1 M NaCl (58 g/L), and 5 mM MgSO4·7H2O (1.23 

g/L)) was added to the filtrate, mixed well, and left at 4 °C for 24 h. After that, mixtures were centrifuged at 12,000 × _g_ for 10 min at 4 °C to pellet the M13 phage-based

EC-CapsidM13Cas13a__bla_IMP-1. To improve its purity, repeated centrifugation was carried out. Eventually, SM buffer (50 mM Tris-HCl (pH 7.5), 0.1 M NaCl, 7 mM MgSO4·7H2O, and 0.01% gelatin)

was added and the pellet was resuspended to generate a final solution of the M13 phage-based EC-CapsidM13Cas13a__bla_IMP-1. A series of M13 phage-based EC-CapsidM13Cas13a(s) targeting the

genes of _bla_NDM-1, _bla_KPC-2, _bla_VIM-2, _bla_OXA-48, _mcr_-1, _mcr_-2, and _rfp_ were also prepared by using the same methods. GENERATION OF PICI-BASED EC-CAPSIDCAS13A AND EC-CAPSIDCAS9

The _E. coli_ JP12507 (ref. 25), derived by lysogenizing phage Φ80 into _E. coli_ 594 strain, was used for the generation of PICI-based EC-CapsidCas13a(s). To prevent Φ80 from being

self-packaged during generation of PICI-based EC-CapsidCas13a, the _cos_N site necessary for phage DNA packaging was deleted to create JP17091. By using JP17091 and a series of PICImid

pKLC31s, PICI-based EC-CapsidCas13a(s)::KanR targeting various genes were generated as follows. First, the pKLC31__bla_IMP-1 was transformed into JP17091, and the transformants were cultured

on Km-containing LB plates. Then, several colonies were isolated and further cultured at 37 °C with shaking in LB liquid medium containing Km together with adding mitomycin C for induction

of prophage excision and L-arabinose for induction of _rpp_A (for phage DNA packaging). The L-arabinose was added to a final concentration of 0.2% that allowed it to reach its final

concentration of 2 µg/mL when the bacteria culture reached to OD600 of 0.1. The cultures were incubated overnight at 30 °C with shaking at 80 r.p.m. After incubation, the supernatant was

harvested and passed through a 0.22 µm filter. The same amount of PEG buffer was then added and the solution was left at 4 °C for at least 1 h after being mixed well. Then, the solution was

centrifuged at 12,000 × _g_ for 10 min at 4 °C, resulting in precipitation of PICI-based EC-CapsidCas13a::KanR__bla_IMP-1. To remove residual liquids, the pellet was washed several times and

finally resuspended in SM buffer for further use. A series of PICI-based EC-CapsidCas13a::KanR(s) targeting the genes of _bla_NDM-1, _bla_KPC-2, _bla_VIM-2, _bla_OXA-48, _mcr_-1, _mcr_-2,

and _rfp_ were also prepared by using the same methods. The PICI-based EC-CapsidCas13a::HygroR carrying _hygroR_ instead of _kanR_ was generated by using plasmid pKLC44, in which _kanR_ was

replaced by _hygorR_. We constructed the pKLC44 by cutting the pKLC31 with SacI and XhoI and combining it with _hygroR_ amplified from pKLC26 HygroR with the primer pair of InF44 pKLC42-f

and InF44 pKLC42-r, using In-Fusion HD Cloning Kit. We generated PICI-based EC-CapsidCas9 targeting _bla_NDM-1 (EC-CapsidCas9__bla_NDM-1), using the JP17091 strain and plasmid pKLC27

(carrying CRISPR-Cas9__bla_NDM-1, _rpp_A and packaging site _cos_N). The pKLC27 was constructed as follows. The CRISPR-Cas9__bla_NDM-1 was amplified from the pCR319 (a gift from Timothy Lu)9

using primer a set of InF27 pRC319-f and InF27 pRC319-r, and the packaging site _cos_N and _rppA_ were amplified from pBAD18 _cos_N _rppA_ using primers of InF27 araCosPPi-f and InF27

araCosPPi-r. The two amplicons were then ligated with In-Fusion HD Cloning Kit to generate pKLC27. The vector for PICI-based EC-CapsidCas9 targeting _bla_IMP-1 (EC-CapsidCas9__bla_IMP-1) was

generated by replacing CRISPR-Cas13a of pKLC31 with CRISPR-Cas9 using two restriction enzymes, SbfI and BglII. GENERATION OF SAPI-BASED SA-CAPSIDCAS13A__MECA_ The SaPI-based

SA-CapsidCas13a__mecA_ was generated basically using a SaPI packaging system11,30. First, the _S. aureus–E.coli_ shuttle vector pKLC-SP__mecA_ carrying CRISPR-Cas13a__mecA_ targeting _mecA_

of MRSA and the control vector pKLC-SP_null were individually transformed into _S. aureus_ strain RN4220-80α-∆_terS_-SaPIbov2::tetM29,33 by electroporation, using NEPA21 electroporator (Nepa

Gene Co., Ltd., Japan) with the following parameters: poring pulse (voltage: 1800 V, pulse length: 2.5 ms, pulse interval: 50 ms, number of pulse: 1, and polarity: +) and transfer pulse

(voltage: 100 V, pulse length: 99 ms, pulse interval: 50 ms, number of pulse: 5, and polarity: ±). The resulting transformants were then recovered at a temperature that permitted plasmid

replication (28 °C) for 1 h and plated on tryptic soy agar (TSA) plates supplemented with 10 µg/mL Cm. The plasmid can be integrated into the chromosome by homologous recombination when the

transformants were incubated at 37 °C (nonpermissive temperature) in the presence of Cm. To stimulate rolling cycle replication, single colonies (from 37 °C plate) were then inoculated into

tryptic soy broth and incubated at 28 °C without antibiotic selection. Finally, 100 µl of the 10−5 dilution of this culture was plated on TSA with 1 µg/mL aTc to select cells free of

plasmid. Insertion of both CRISPR-Cas13a systems was validated by PCR. Finally, resulting cells were chemically induced by mitomycin C to generate SA-CapsidCas13a__mecA_ and

SA-CapsidCas13a_nontargeting (control) by using the method described elsewhere11. _E. COLI_ STRAIN WITH CHROMOSOMALLY INTEGRATED GENES The generation of _E. coli_ strain expressing foreign

gene on its own chromosome was carried out by using ARA-inducible Red recombination system. First, we transformed _E. coli_ strains NEB5-alpha F′_I_q (New England Biolabs, US) and MC1061

with plasmid pKD46 that carries ARA-inducible Red recombination system34. Next, the desired genes, e.g., _bla_IMP-1, were knocked-in into the above strains following the methods described by

Tomoya Baba et al.35. A DNA fragment containing _bla_IMP-1 and Cm resistance gene (_cat_) was amplified from the pKLC26__bla_IMP-1 with a primer pair of K12 genome-in pKLC26-f and K12

genome-in pKLC26 Cm-r, and the PCR product was electroporated into the above _E. coli_ cell using ELEPO 21 with the following parameters: poring pulse (voltage: 2000 V, pulse length: 2.5 ms,

pulse interval: 50 ms, number of pulses: 1, and polarity: +) and transfer pulse (voltage: 150  V, pulse length: 50 ms, pulse interval: 50 ms, number of pulses: 5, and polarity: ±). After

electroporation, 1 mL of SOC was added and the mixture was cultured at 37 °C for 1 h with agitation, before spreading on LB plate containing Cm and further incubated at 37 °C until colonies

were observed. The sequence of the resulting insertion was confirmed by Sanger sequencing. BACTERIAL CELL GROWTH INHIBITORY TEST ON PLATE The pKLC21__bla_IMP-1_563 (Cas13a and

crRNA__bla_IMP-1_563 expression plasmid) and the pKLC54__bla_IMP-1_560 (Cas9 and crRNA__bla_IMP-1_560 expression plasmid) targeting _bla_IMP-1 were constructed as mentioned above. The

CRISPR-Cas expression plasmid was transformed into _E. coli_ STBL3(pKLC45) (as a control) and STBL3(pKLC53) (_bla_IMP-1 expression plasmid). Each transformant was then plated onto LB plates

containing Km, and incubated at 30 °C for 16 h. After that, colonies on the plates were collected and serially diluted with 0.8 % NaCl, and a colony count for the number of surviving cells

was carried out. BACTERIAL CELL GROWTH INHIBITORY TEST IN CULTURE MEDIUM The pKLC21__bla_IMP-1_563, the pKLC21__bla_IMP-1_RFP and the pKLC21__bla_IMP-1_nontargeting were transformed into _E.

coli_ STBL3(pKLC56) (as a control), STBL3(pKLC56__bla_IMP-1) (aTc-inducible _bla_IMP-1 expression plasmid), and STBL3(pKLC56_RFP) (aTc-inducible RFP expression plasmid). Each transformant

was then plated onto LB plates containing Km and Cm, and incubated at 37 °C for 16 h. The colonies on the plates were transferred to an LB culture medium containing Km and Cm, and incubated

at 37 °C for 10 h. After confirming that the bacteria had grown well, each culture was diluted 100-fold with LB medium, and incubated at 30 °C for 1.5 h with vigorous shaking (400 r.p.m.).

Then, 1 µg/mL aTc was added to induce the expression of _bla_IMP-1 and _rfp_, and incubated at 30 °C for 1 h with vigorous shaking. After that, antibiotics (Km and Cm, and Amp) were added

into the culture, and incubated at 30 °C for 23 h with vigorous shaking. OD650 of each well was monitored every hour. CELL VIABILITY TEST AFTER INTRODUCING CRISPR-CAS13A The

pKLC21__bla_IMP-1_563 was transformed into _E. coli_ STBL3(pKLC56__bla_IMP-1) and the bacteria was plated onto LB plates containing Km and Cm, and incubated at 37 °C for 16 h. The colonies

on the plates were transferred to an LB culture medium containing Km and Cm, and incubated at 37 °C for 10 h. The bacterial culture was diluted 100-fold with LB medium, then 1 µg/mL of aTc

and the antibiotics Km and Cm were added, followed by incubation at 30 °C for 8 h. The bacteria culture was vigorously shaken for 10 s every 1 h just prior to measuring OD. The bacteria were

collected at the time point of 0 h, 1 h, 2 h, 4 h, and 8 h after the treatment, and serially diluted with 0.8% NaCl. Diluted bacteria were spotted on the LB plate without antibiotics and

the number of surviving cells were counted. SEQUENCE-SPECIFIC BACTERIAL KILLING BY EC-CAPSIDCAS13A The logarithmic phase cultures of three _E. coli_ strains with overexpression of

_bla_IMP-1, _mcr-2_ in plasmid and carrying control plasmid, NEB5-alpha F′_I_q (pKLC26__bla_IMP-1), and NEB5-alpha F′_I_q (pKLC26__mcr-2_) and NEB5-alpha F′_I_q (pKLC26), in LB liquid medium

were adjusted to an OD600 of 0.1, and diluted ten times with fresh LB medium. We transferred 300 μl of each dilution into one tube, mixed well, then divided them into four tubes up to 100 

μl for each tube. Three tubes were treated with M13-based EC-CapsidCas13a__bla_IMP-1, EC-CapsidCas13a__mcr-2_, and EC-CapsidCas13a_nontargeting (control), respectively, while the fourth tube

was regarded as non-treated control. EC-CapsidCa13a treatments were carried out by individually adding MOI 100 of the above three CapsidCas13a(s) to their corresponding tubes, mixing well,

then culturing at 37 °C with gentle shaking for 6 h. After incubation, serial dilutions were made with 0.8% NaCl and a colony count for the number of survived cells was carried out. The

number of colonies that formed on the agar plates containing Amp, colistin, and drug free, respectively, were counted, and cell ratios were calculated. The sequence-specific killing activity

of SA-CapsidCas13a__mecA_ was determined by using Tet agar plate, since SA-CapsidCas13a(s) generated were carrying Tet resistance determinant delivered from SaPIbov2 during the packaging

processes. MEASUREMENT OF PHAGE TITERS The M13 phage/PICI-based EC-CapsidCas13a(s) were serially diluted with SM buffer ranging from 10−4 to 10−7. In the meantime, overnight culture of _E.

coli_ strain NEB5-alpha F′_I_q or MC1061 diluted 1:100 with LB broth was incubated with agitation at 37 °C until an OD600 of ~0.1 was obtained. Then, 10 µl of each dilution of M13

phage/PICI-based EC-CapsidCas13a(s) was added to 100 µl of bacterial suspension and the mixture was incubated at 37 °C for 30 min. Subsequently, all of the culture solution was plated on LB

plates containing Cm or Km, and the plates were incubated overnight at 37 °C. The colonies grown on the Km plate but not on the Cm were counted to calculate the TFU/mL. DETECTION OF

BACTERIAL GENES WITH CAPSIDCAS13A(S) The _E. coli_ strains to be determined were grown to an OD600 of ~0.5. Then, 100 µl of the culture were mixed with 3 mL molten soft agar (LB solution

with 0.5% agarose) prewarmed at 50 °C and poured onto an LB plate containing Km or Hygro. The plates were solidified at room temperature. Meanwhile, M13 phage/PICI-based EC-CapsidCas13a with

known titers was adjusted to 105 TFU/mL and its tenfold serial dilutions were prepared. Finally, 2 µL of each dilution of the M13 phage/PICI-based EC-CapsidCas13a were spotted onto the

solidified soft agar and the plates were incubated at 37 °C. The result was interpreted as positive if bactericidal plaque formed on the plate. PKLC21__BLA_ IMP-1 LIBRARY SEQUENCING The

pKLC21__bla_IMP-1 (CRISPR-Cas13a__bla_IMP-1 expression plasmid) library targeting the whole region of _bla_IMP-1 was constructed as aforementioned. Equal amounts of each of the 121

pKLC21__bla_IMP-1 carrying spacers against different position of _bla_IMP-1 and pKLC21_nontargeting (as a control) were mixed and transformed into _E. coli_ MC1061(pKLC26) and

MC1061(pKLC26__bla_IMP-1). Each transformant was then plated onto 20 LB plates containing Cm and Km, and incubated at 37 °C for 16 h. Next, >10,000 colonies for each transformant were

harvested by using LB medium, and plasmids were extracted using QIAGEN Plasmid Midi Kit (QIAGEN). Pair-end sequencing libraries were constructed from the plasmids using Nextera XT Library

Prep Kit (Illumina). Sequencing was performed using Illumina MiSeq platform (2 × 301 bp) with MiSeq reagent kit version 3 (Illumina). _G. MELLONELLA_ SURVIVAL ASSAY The M-sized _G.

mellonella_ larvae purchased from Ikiesa factory (Osaka, Japan) were used for the survival assay to assess the effect of PICI-based EC-CapsidCas13a on treatment of _E. coli_ infections. Upon

receipt, the larvae were acclimated to the laboratory environment by leaving them in a dark room for 24 h before starting the assay. Larvae with weak movement, dark color, unusual shape,

and sizes that differed distinctly from other larvae were excluded from the experiment. A Hamilton syringe (701LT, Hamilton) and a KF 731 needle (Hamilton) were used in this experiment.

First, overnight culture of carbapenem-resistant _E. coli_ R10-61 carrying the carbapenem resistance gene _bla_IMP-1 was diluted at 1:1000 with fresh LB medium and further incubated at 37 °C

with agitation to reach an OD600 of ~0.5. The bacteria were then washed twice with PBS and adjusted to a density of ~1 × 107 CFU/mL in PBS. Thirty cream-colored larvae for each group were

selected and 5 µl of bacterial suspension was directly injected into the left proleg. One hour later, 5 µl of PBS containing MOI 100 of PICI-based EC-CapsidCas13a__bla_IMP-1,

EC-CapsidCas13a_nontargeting, or PBS only, were injected into the same site where bacteria solution had been injected. The larvae were transferred to a 37 °C incubator, and the survival was

monitored for up to 3 days. Larvae that did not respond to stimulation with needles or whose bodies deformed were counted as dead. Kaplan–Meier survival curves were then generated from data

of three independent experiments and analyzed with log-rank test using software EZR (http://www.jichi.ac.jp/saitama-sct/SaitamaHP.files/statmedEN.html). REPORTING SUMMARY Further information

on research design is available in the Nature Research Reporting Summary linked to this Article. DATA AVAILABILITY The data that support the findings in this study are available upon

reasonable request from the corresponding author. Data supporting the findings of this study are available within the Article and Supplementary Information. Bacteria list, plasmid list,

primer list, and the screening results are available in the Supplementary Tables. Figures 1c, e, f, 3 and 4, and Supplementary Figs. 1, 2, 6a, e are provided as a Source Data file. CHANGE

HISTORY * _ 09 JULY 2020 The original version of this Article was updated shortly after publication, because the Peer Review file was inadvertently omitted. The error has now been fixed and

the Peer Review PDF is available to download from the HTML version of the Article. _ REFERENCES * World Health Organization. _Global Antimicrobial Resistance Surveillance System (GLASS)

Report: Early Implementation 2016–2017_ (WHO, 2018). * Centers for Disease Control and Prevention. _2019 AR Threats Report. Biggest Threats and Data_ (CDC, 2019). * Piddock, L. J. V.

Reflecting on the final report of the O’Neill review on antimicrobial resistance. _Lancet Infect. Dis._ 16, 767–768 (2016). Article  Google Scholar  * Hutchings, M. I., Truman, A. W. &

Wilkinson, B. Antibiotics: past, present and future. _Curr. Opin. Microbiol._ 51, 72–80 (2019). Article  CAS  Google Scholar  * de la Fuente-Nunez, C., Torres, M. D., Mojica, F. J. & Lu,

T. K. Next-generation precision antimicrobials: towards personalized treatment of infectious diseases. _Curr. Opin. Microbiol._ 37, 95–102 (2017). Article  Google Scholar  * Reardon, S.

Modified viruses deliver death to antibiotic-resistant bacteria. _Nature_ 546, 586–587 (2017). Article  ADS  CAS  Google Scholar  * Yosef, I., Manor, M., Kiro, R. & Qimron, U. Temperate

and lytic bacteriophages programmed to sensitize and kill antibiotic-resistant bacteria. _Proc. Natl Acad. Sci. USA_ 112, 7267–7272 (2015). Article  ADS  CAS  Google Scholar  * Greene, A. C.

CRISPR-based antibacterials: transforming bacterial defense into offense. _Trends Biotechnol._ 36, 127–130 (2018). Article  CAS  Google Scholar  * Citorik, R. J., Mimee, M. & Lu, T. K.

Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. _Nat. Biotechnol._ 32, 1141–1145 (2014). Article  CAS  Google Scholar  * Bikard, D. et al. Exploiting

CRISPR-cas nucleases to produce sequence-specific antimicrobials. _Nat. Biotechnol._ 32, 1146–1150 (2014). Article  CAS  Google Scholar  * Ram, G., Ross, H. F., Novick, R. P.,

Rodriguez-Pagan, I. & Jiang, D. Conversion of staphylococcal pathogenicity islands to crispr-carrying antibacterial agents that cure infections in mice. _Nat. Biotechnol._ 36, 971–976

(2018). Article  CAS  Google Scholar  * Hamilton, T. A. et al. Efficient inter-species conjugative transfer of a CRISPR nuclease for targeted bacterial killing. _Nat. Commun._ 10, 4544

(2019). Article  ADS  Google Scholar  * Shmakov, S. et al. Discovery and functional characterization of diverse Class 2 CRISPR-Cas systems. _Mol. Cell_ 60, 385–397 (2015). Article  CAS 

Google Scholar  * Abudayyeh, O. O. et al. C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. _Science_ 353, aaf5573 (2016). Article  Google Scholar  * Meeske,

A. J., Nakandakari-Higa, S. & Marraffini, L. A. Cas13-induced cellular dormancy prevents the rise of CRISPR-resistant bacteriophage. _Nature_ 570, 241–245 (2019). Article  ADS  CAS 

Google Scholar  * Watanabe, S. et al. Composition and diversity of CRISPR-Cas13a systems in the genus Leptotrichia. _Front. Microbiol._ 10, 2838 (2019). Article  Google Scholar  * López, C.,

Ayala, J. A., Bonomo, R. A., González, L. J. & Vila, A. J. Protein determinants of dissemination and host specificity of metallo-β-lactamases. _Nat. Commun._ 10, 3617 (2019). Article 

ADS  Google Scholar  * Andersson, D. I. The biological cost of mutational antibiotic resistance: any practical conclusions? _Curr. Opin. Microbiol._ 9, 461–465 (2006). Article  CAS  Google

Scholar  * Buckner, M. M. C. et al. Clinically relevant plasmid-host interactions indicate that transcriptional and not genomic modifications ameliorate fitness costs of Klebsiella

pneumoniae carbapenemase-carrying plasmids. _mBio_ 9, e02303–e02317 (2018). Article  CAS  Google Scholar  * Cui, X., Zhang, H. & Du, H. Carbapenemases in Enterobacteriaceae: detection

and antimicrobial therapy. _Front. Microbiol._ 10, 1823 (2019). Article  Google Scholar  * Deveau, H. et al. Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. _J.

Bacteriol._ 190, 1390–1400 (2008). Article  CAS  Google Scholar  * van Houte, S. et al. The diversity-generating benefits of a prokaryotic adaptive immune system. _Nature_ 532, 385–388

(2016). Article  ADS  Google Scholar  * Pyenson, N. C., Gayvert, K., Varble, A., Elemento, O. & Marraffini, L. A. Broad targeting specificity during bacterial type III CRISPR-Cas

immunity constrains viral escape. _Cell Host Microbe_ 22, 343–353 (2017). Article  CAS  Google Scholar  * Yamamoto, N. et al. Prevalence of, and risk factors for, carriage of

carbapenem-resistant Enterobacteriaceae among hospitalized patients in Japan. _J. Hosp. Infect._ 97, 212–217 (2017). Article  CAS  Google Scholar  * Fillol-Salom, A. et al. Hijacking the

hijackers: Escherichia coli pathogenicity islands redirect helper phage packaging for their own benefit. _Mol. Cell_ 75, 1020–1030 (2019). Article  CAS  Google Scholar  * Fillol-Salom, A. et

al. Phage-inducible chromosomal islands are ubiquitous within the bacterial universe. _ISME J._ 12, 2114–2128 (2018). Article  CAS  Google Scholar  * Gootenberg, J. S. et al. Nucleic acid

detection with CRISPR-Cas13a/C2c2. _Science_ 356, 438–442 (2017). Article  ADS  CAS  Google Scholar  * Hiramatsu, K., Cui, L., Kuroda, M. & Ito, T. The emergence and evolution of

methicillin-resistant Staphylococcus aureus. _Trends Microbiol._ 9, 486–493 (2001). Article  CAS  Google Scholar  * Ubeda, C. et al. Specificity of staphylococcal phage and SaPI DNA

packaging as revealed by integrase and terminase mutations. _Mol. Microbiol._ 72, 98–108 (2009). Article  CAS  Google Scholar  * Penadés, J. R., Chen, J., Quiles-Puchalt, N., Carpena, N.

& Novick, R. P. Bacteriophage-mediated spread of bacterial virulence genes. _Curr. Opin. Microbiol._ 23, 171–178 (2015). Article  Google Scholar  * Suzuki, M. et al. Helicobacter pylori

CagA phosphorylation-independent function in epithelial proliferation and inflammation. _Cell Host Microbe_ 5, 23–34 (2009). Article  CAS  Google Scholar  * Sato’o, Y. et al. Tailor-made

gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference. _PLoS ONE_ 13, e0185987 (2018). Article  Google Scholar  * Maiques, E. et al. Role of staphylococcal phage

and SaPI integrase in intra- and interspecies SaPI transfer. _J. Bacteriol._ 189, 5608–5616 (2007). Article  CAS  Google Scholar  * Datsenko, K. A. & Wanner, B. L. One-step inactivation

of chromosomal genes in Escherichia coli K-12 using PCR products. _Proc. Natl Acad. Sci. USA_ 97, 6640–6645 (2000). Article  ADS  CAS  Google Scholar  * Baba, T. et al. Construction of

Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. _Mol. Syst. Biol._ 2, 2006.0008 (2006). Article  Google Scholar  Download references ACKNOWLEDGEMENTS We

thank Dr. Feng Zhang of the Massachusetts Institute of Technology, Dr. Luciano Marraffini of The Rockefeller University, Dr. David Bikard of The Institut Pasteur, Dr. Motoyuki Sugai of

National Institute of Infectious Diseases, and Dr. Timothy Lu of the Massachusetts Institute of Technology for kindly gifting the plasmids used in this study. We thank the Hibiki Research

Group for Clinical Microbiology for kindly providing the carbapenem-resistant _E. coli_ strains R10-61 and R10-79. We thank Dr. Keiichi Hiramatsu of Juntendo University for kindly providing

the USA300 strain. We thank Dr. Dai Akine of Jichi Medical University for kindly providing the _E. coli_ strains. We thank Dr. Ramesh Wigneshweraraj of Imperial College London for his

advice. This work was supported by the Japan Agency for Medical Research and Development J-PRIDE (grant nos. JP17fm0208028, JP18fm0208028, and JP19fm0208028 to L.C.) and the Research Program

on Emerging and Re-emerging Infectious Diseases (JP19fk0108093 to M.S.), JSPS KAKENHI (grant nos. 18K15149 to K.K., 15H05654 and 19K08960 to S.W., 17K15691 to Y.S., 19K15740 to M.K., and

17K19570 to L.C.), Mochida Memorial Foundation for Medical and Pharmaceutical Research (K.K.), Takeda Science Foundation (S.W. and L.C.), and Daiwa Foundation (J.R.P.). The funders had no

role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. AUTHOR INFORMATION AUTHORS AND AFFILIATIONS * Division of Bacteriology,

Department of Infection and Immunity, School of Medicine, Jichi Medical University, Tochigi, Japan Kotaro Kiga, Xin-Ee Tan, Shinya Watanabe, Yoshifumi Aiba, Yusuke Sato’o, Feng-Yu Li, Teppei

Sasahara, Bintao Cui, Moriyuki Kawauchi, Tanit Boonsiri, Kanate Thitiananpakorn, Yusuke Taki, Aa Haeruman Azam & Longzhu Cui * Institute of Infection, Immunity & Inflammation,

University of Glasgow, Glasgow, G12 8TA, UK Rodrigo Ibarra-Chávez & José R. Penadés * Antimicrobial Resistance Research Center, National Institute of Infectious Diseases, Tokyo, Japan

Masato Suzuki Authors * Kotaro Kiga View author publications You can also search for this author inPubMed Google Scholar * Xin-Ee Tan View author publications You can also search for this

author inPubMed Google Scholar * Rodrigo Ibarra-Chávez View author publications You can also search for this author inPubMed Google Scholar * Shinya Watanabe View author publications You can

also search for this author inPubMed Google Scholar * Yoshifumi Aiba View author publications You can also search for this author inPubMed Google Scholar * Yusuke Sato’o View author

publications You can also search for this author inPubMed Google Scholar * Feng-Yu Li View author publications You can also search for this author inPubMed Google Scholar * Teppei Sasahara

View author publications You can also search for this author inPubMed Google Scholar * Bintao Cui View author publications You can also search for this author inPubMed Google Scholar *

Moriyuki Kawauchi View author publications You can also search for this author inPubMed Google Scholar * Tanit Boonsiri View author publications You can also search for this author inPubMed 

Google Scholar * Kanate Thitiananpakorn View author publications You can also search for this author inPubMed Google Scholar * Yusuke Taki View author publications You can also search for

this author inPubMed Google Scholar * Aa Haeruman Azam View author publications You can also search for this author inPubMed Google Scholar * Masato Suzuki View author publications You can

also search for this author inPubMed Google Scholar * José R. Penadés View author publications You can also search for this author inPubMed Google Scholar * Longzhu Cui View author

publications You can also search for this author inPubMed Google Scholar CONTRIBUTIONS K.K. and L.C. designed the study, analyzed the data, and wrote the manuscript. X.-E.T. and R.-I.C.

contributed to the acquisition, analysis and interpretation of data, and assisted the preparation of the manuscript. J.R.P. contributed to design of the study, interpretation of data, and

assisted the preparation of the manuscript. All other authors contributed to data collection and interpretation and critically revised the manuscript. All authors approved the final version

of the manuscript and agreed on all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work were appropriately investigated and resolved.

CORRESPONDING AUTHOR Correspondence to Longzhu Cui. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing interests. ADDITIONAL INFORMATION PEER REVIEW INFORMATION _Nature

Communications_ thanks Alexander Hynes and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available. PUBLISHER’S NOTE

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION PEER REVIEW FILE

REPORTING SUMMARY SOURCE DATA SOURCE DATA RIGHTS AND PERMISSIONS OPEN ACCESS This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use,

sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative

Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated

otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds

the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Reprints and

permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Kiga, K., Tan, XE., Ibarra-Chávez, R. _et al._ Development of CRISPR-Cas13a-based antimicrobials capable of sequence-specific killing of

target bacteria. _Nat Commun_ 11, 2934 (2020). https://doi.org/10.1038/s41467-020-16731-6 Download citation * Received: 11 November 2019 * Accepted: 13 May 2020 * Published: 10 June 2020 *

DOI: https://doi.org/10.1038/s41467-020-16731-6 SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is

not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative