ABSTRACT _Rauvolfia nukuhivensis_ is a well-known plant used for its wide range of beneficial effects in Marquesas islands. It is made up of diverse indole alkaloids and is used as

traditional medicine for skin application. The actual mechanism behind the virtue of this plant is still unknown. Hence, in this study we aimed at deciphering the impact of _R_.

_nukuhivensis_ on skin immune system in context of (1) homeostasis, (2) pathogen infection and (3) inflammation. Here we show that _R_. _nukuhivensis_ enhances cellular metabolic activity

and wound healing without inducing cellular stress or disturbing cellular homeostasis. It reinforces the epithelial barrier by up-regulating hBD-1. Nevertheless, in pathogenic stress, _R_.

the several cutaneous application potentials of _R_. _nukuhivensis_ such as boosting the immune response or in restoring the integrity of the epithelial barrier. SIMILAR CONTENT BEING VIEWED

BY OTHERS PYROMECONIC ACID-ENRICHED _ERIGERON ANNUUS_ WATER EXTRACT AS A COSMETIC INGREDIENT FOR ITCH RELIEF AND ANTI-INFLAMMATORY ACTIVITY Article Open access 26 February 2024

ANTI-INFLAMMATORY AND BARRIER REPAIR MECHANISMS OF ACTIVE COMPONENTS IN _DAEMONOROPS DRACO_ BL. FOR UVB-INDUCED SKIN DAMAGE Article Open access 17 May 2025 IN VITRO PROTECTIVE EFFECTS OF

_PAEONIA OFFICINALIS_ VAR. _MASCULA_ CALLUS EXTRACT ON HUMAN KERATINOCYTES Article Open access 05 November 2020 INTRODUCTION Natural products play an important role in the field of new drugs

research and development. Traditional medicine has a long history of serving civilization all over the world. Ancient ancestry believed that a disease has a natural cause, so natural herbal

remedies can treat it. It is only from 19th century that researchers started to isolate the active principle from medicinal plants that became important clinical agents such as ajmalicine

and reserpine used for hypertension treatment1,2,3,4,5. _Rauvolfia_ is a genus of the _Apocynaceae_ family characterized by their indole composition6,7,8,9. _Rauvolfia_ genus includes more

than 100 species that are native to tropical and subtropical regions of the world. _R_. _nukuhivensis_ is one of these endemic species that belong to the Marquesas archipelago from French

Polynesia. In traditional medicine, the extracts of this flowering plant are still excessively used for skin issues namely for women intimate care and wound healing5,10. The absence of

scientific explanation of the plant virtues resulted in its uncontrolled usage that critically endangered this species. In fact, the biological characterization of _R_. _nukuhivensis_

extract (RNE) is essential to limit its extinction and to comprehend its impact on the cutaneous physiological-immunological mechanisms. Therefore, this study aimed at defining the role of

RNE in skin biology by studying its impact on the skin immune system from cellular activities to innate immune responses in homeostasis, in pathogenic stress and in inflammation. The study

was performed on keratinocytes (KCs) which constitute over 95% of the epidermal cell type and are the first sensors of pathogen invasion11,12. Moreover, the skin contains a highly dynamic

immune system that is dependent on a cross-talk between KCs and other sentinels of the immune system11. This connected network is governed by KCs that are in constant contact with the

external environments ensuring skin barrier function and defense mechanisms for homeostasis maintenance. Hence, different cutaneous components are mobilized to preserve the skin integrity

through innate immunity, which is the most active and effective actor against daily life external insults challenges13. To face that, the skin renews itself each month ensuring by that skin

restoration, rejuvenation and reepithelization. This process involves a complex interplay between several cutaneous innate and adaptive actors such as antimicrobial peptides (AMPs),

inflammatory mediators and proliferative cytokines such as IL-22. For instance, AMPs generation by the innate immune system is essential for epithelial barrier preservation14. In human,

β-defensins (hBD) have been identified in skin and constitute the most expressed AMPs15. Four types of cutaneous β-defensins (hBD-1, 2, 3 and 4) are differentially expressed either in

constitutive or inducible manner16. hBD-1 constitutively expressed in keratinocytes is responsible of cutaneous immunosurveillance. However, hBD-2 and hBD-3 are induced upon pathogens

invasion and inflammation17,18,19. When the skin is challenged with pathogens, an inflammatory response is mediated by the innate immune system to clear and neutralize them. This pathogen

invasion danger is sensed by KCs via their innate receptors such as TLRs enabling innate inflammatory pathways activation. TLR5 is one of the most expressed receptor on KCs surface20,21.

Indeed, it is activated by Flagellin which is the major constituent of bacterial flagella. The subsequent activation results in NF-κB signaling leading to increased proinflammatory mediators

such as CXCL-8, IL-6 and IL-2222,23,24,25. In some cases, this response becomes uncontrolled and causes cellular processes perturbations resulting in inflamed epidermis. In fact, several

skin disorders are characterized by unbalanced KCs proliferation and differentiation caused by increased inflammatory environment enriched by IL-22. This key cytokine acts as a shuttle

between leukocytes and epithelia in non-hematopoietic cells at body barriers including epithelial cells of the lung, gastrointestinal tract and KCs in the skin26,27,28. Nevertheless,

continuous exacerbated or uncontrolled IL-22 signaling leads to undesirable tissue inflammation, accelerating certain immune pathologies such as psoriasis, atopic dermatitis and rheumatoid

arthritis29,30,31,32. IL-22 belongs to IL-10 family and is mainly produced by CD4+ effector T (Teff) cells as well as innate lymphoid cells 3 (ILC3)33. It signals through the IL-22R1/IL-10R2

complex and subsequent JAK–signal transducer, activator of transcription (STAT) signaling pathways (anti-apoptosis, cell cycle, differentiation…) and the mitogen-activating peptide kinase

pathway34,35,36. So, IL-22 has an important role in the maintenance of epithelial integrity at barrier surfaces37,38. Its main physiological job includes reinforcement of epithelium barrier

function through induction of hBD-2 and hBD-3 in context of infection14,17,18,19,26,27,39,40, wound healing through promotion of epithelial cell proliferation and survival following tissue

damage in pathophysiological conditions41,42,43. Hence, the fine-tuning of IL-22 signaling implicated in these processes can be beneficial to treat skin disorders. The aim of the study is to

define the impact of RNE on skin innate immunity in homeostatic and non-homeostatic conditions. To this purpose, we first evaluated the cellular stress induced by RNE through cytotoxicity

and oxidative tests. Then, we looked at the wound healing properties by following wound closure over time and skin barrier functions by defining the relative expression of genes belonging to

β-defensins family. We assessed the impact of the extract on skin inflammatory response using a variety of assays. Last but not least, we investigated the role of RNE in IL-22 induced

proliferation by evaluating gene expression implicated in proliferation processes which are deregulated by IL-22 stimulation. RESULTS RNE ENHANCES WOUND-HEALING PROPERTIES WITHOUT DISTURBING

CELLULAR PROCESSES The first challenge was to define the non-cytotoxic effective concentration of RNE to be used since the extract is composed of alkaloids that can be toxic for the cells.

Thus, we achieved a kinetic of a dose-response experiment that showed the absence of cytotoxicity and enhanced viability profile below 300 µg/mL for cells treated during 24 h and 48 h (see

supplementary Fig. S1). For this study, the concentration of 200 µg/mL was chosen and used throughout the experiments. Then, we investigated the impact of RNE on cellular processes in steady

state condition. We checked the metabolic activity by an XTT assay, cellular cytotoxicity by an LDH assay, cellular proliferation by a Ki67 staining, and oxidative stress by ROS and H2O2

production. The stimulation of HaCaT with RNE for 24 h didn’t have any cytotoxicity effects (Fig. 1). However, a significant increase (around 40%) of the metabolic activity was recorded

compared to unstimulated cells (Fig. 1b). Yet, the percentage of Ki67 positive cells was similar in presence or absence of RNE (Fig. 1c). Hence, to verify if RNE causes any cellular stress,

we performed a seahorse test that consists of quantifying different parameters of mitochondrial respiration. The seahorse test showed a similar profile between untreated and RNE treated

HaCaT confirming by that the absence of mitochondrial dysfunction (See supplementary Fig. S2). Similarly, RNE failed to induce ROS and H2O2 production showing the absence of an oxidative

stress (Fig. 1d,e). Since Polynesian people use RNE to treat skin wounds, we performed a wound-healing assay. One essential step of the healing process is the epithelialization ensured by

cell migration, which is the major read out of this assay. HaCaT stimulated with RNE showed a significant increase of keratinocyte migration into the cell free area resulting in almost

complete recovery at 92 h compared to unstimulated cells (Fig. 2a). RNE application resulted in 30% wound closure improvement with respect to untreated cells (Fig. 2b). RNE IMPACTS ON

DEFENSIN GENE EXPRESSION AND INFLAMMATORY CYTOKINE SECRETION Here, we investigated the effect of RNE on β-defensins mRNA expression (Fig. 3). HaCaT were incubated with RNE for 24 h and gene

expression was analyzed using real-time qPCR. The results revealed a significant increase of 6.2-fold for the constitutive hBD-1 (Fig. 3a) whereas a decreased tendency profile (~2-fold) for

the inducible hBD-2 and hBD-3 (Fig. 3b,c) was observed. The traditional usage of _R_. _nukuhivensis_ to treat cutaneous infections prompted us to study its impact on inflammatory response in

presence of Flagellin (TLR5 agonist) a well-characterized inflammatory pathway in KCs. To this aim, KCs were stimulated with 0.5 μg/mL Flagellin in presence or absence of RNE during 24 h.

Then, TLR5 mRNA expression was measured by RT-qPCR and CXCL-8 and IL-6 secretion were assessed by ELISA. TLR5 gene relative expression was increased by 2-fold for 0.5 μg/mL Flagellin treated

KCs whereas 3-fold increase was observed for RNE treated KCs compared to control (Fig. 4b). Nevertheless, the co-stimulation of KCs with Flagellin and RNE resulted in the highest

up-regulation that reached a 4-fold increase compared to basal expression (Fig. 4a). Accordingly, the evaluation of inflammatory mediators showed a significant increased production of CXCL-8

and IL-6 upon Flagellin stimulation while RNE stimulation didn’t induce cytokine production (Fig. 4c,d). The co-stimulation Flagellin with RNE resulted in the highest CXCL-8 and IL-6

production (Fig. 4c,d). Finally, the activation of NF-κB was assayed to confirm these observations since TLR5 stimulation leads to NF-κB import inside the nucleus where it acts as

transcription factor (Fig. 4a). For that, we took use of NF-κB luciferase reporter assay to monitor the activation of NF-κB. KCs were transfected with pNF-CMV-luc reporter vector prior to

stimulation with either Flagellin alone, RNE alone or with both. Enhancement of luciferase activity was observed in Flagellin but not RNE stimulated KCs indicating the activation of NF-κB

pathway in case of Flagellin application and confirming the absence of RNE induced NF-κB dependent stress. In accordance with the previous obtained results, the co-stimulation resulted in

the highest significant (~two fold) luciferase activity compared to Flagellin simulation alone (Fig. 5). RNE IS A NATURAL ANTIPROLIFERATIVE AGENT To further study the impact of _R_.

_nukuhivensis_ in skin, we thought to investigate its possible activity in inflamed hyperproliferative skin. IL-22 cytokine, an IL-10 family member up regulated in skin disorders such as

psoriasis and atopic dermatitis, was used to stress keratinocytes. Indeed, IL-22 is known to induce KCs hyper-proliferation and to inhibit KCs differentiation26,44,45,46. First, we checked

whether the stimulation of KCs with either 50 ng/mL IL-22 alone, RNE alone or co-stimulation with both compounds did induce any cytotoxicity. The LDH assay showed same profile between the

different conditions and non-treated cells indicating the absence of cytotoxicity (Fig. 6a). Then, we measured the mRNA levels of PTEN the negative regulator of cellular proliferation,

Filaggrin the differentiation marker known to be downregulated in presence of IL-22 and BCL-2 the anti-apoptotic molecule. Accordingly, we showed that IL-22 stimulation resulted in their

down-regulation whereas RNE stimulation alone didn’t impact their expression. However, in same experimental conditions, the co-stimulation resulted in PTEN and Filaggrin expression

restoration and BCL-2 downregulation (Fig. 6b–d). All these data point the ability of _R_. _nukuhivensis_ to limit IL-22 induced uncontrolled proliferation. DISCUSSION The aim of this study

is to comprehend the impact of RNE on skin in several contexts. To date, the medicinal cutaneous virtue of this plant remains unknown. In the 50’s Sheuer’s group isolated many alkaloids

including serpentinin, ajmaline, sandwicine, sandwicencine, tetraphylline, tetraphyllicin and mauiensine from _Rauvolfia_ genus47. Alkaloids belonging to the family of Ajmalines common to

the genus _Rauvolfia_ are exploited in pharmacology due to their anti-arrhythmic, anti-depressive, anti-oxidant and anti-tumoral activities. From _R_. _nukuhivensis_, we isolated derivatives

of indolo [2,3-a] quinolizinium (nukuhivensium and N12-methyl-nukuhivensium) and demonstrated their anti-arrhythmic activity, by their action on the hERG potassium channel8,9. Despite these

biological effects, no study addresses the impact of this plant extract on skin that is highly used by locals. This prompted us to investigate the biological effects induced by RNE

stimulation in human keratinocytes. The first set of data indicates that 24 hours cell stimulation with RNE was not harmful but led to an increased metabolic activity; though the

proliferation was not disturbed with any detectable mitochondrial stress. Interestingly, RNE exhibits healing properties since cell treatment with the extract resulted in significant

improved wound closure compared to untreated cells. This is likely due to keratinocytes migration, as the RNE treatment did not increase the cell proliferation compare to untreated cells as

shown by the negative Ki-67 test. Interestingly, this extract did also improve the wound healing of fibroblasts monolayer (data not shown). All these data highlight that this plant extract

has a great potential as ingredient in anti-aging products and treatments by its cellular remodeling effect without disturbing major viability cellular processes. Marquesan women use RNE as

an intimate care, which sounds antimicrobial, or antiseptic-like agent. Previous works showed that this extract lacks of direct antimicrobial activity against the _Candida albicans_,

_Aspergillus niger_, _Escherichia coli and Staphylococcus aureus_ microorganisms8. This prompted us to study nevertheless the impact of RNE on skin barrier function by looking at defensins

expression known to be major contributors in innate immunity and immunosurveillance. Our data clearly showed the ability of RNE to upregulate significantly hBD-1, which is expressed

constitutively in the terminal layer of the skin and ensures cutaneous immunosurveillance. The inducible hBD-2 and hBD-3 were slightly down-regulated. Hence, RNE reinforces the epithelial

barrier by increasing the immunosurveillance defensin rather than the proinflammatory inducible defensins. This result suggested that RNE influences the background regulation of KCs without

inducing an immune-associated response. To go further, we assessed the impact of RNE on the innate immune system. Under normal conditions, RNE up-regulated TLR5 gene expression but did not

induce the usual chemokine (CXCL-8) and cytokine (IL-6) production enhanced in response to external pathogens stimuli. Moreover, in presence of an external stress such as the TLR5 agonist

Flagellin, RNE strengthened the immune response. This led to a more potent and immediate innate immune response via increased chemokine and cytokine production (e.g CXCL-8 and IL-6) in NF-κB

dependent manner. To sum up, RNE seems to act by preparing the immune system of KCs to be more reactive and effective immediately through enhancing its innate immune response by increasing

the amount of Toll-like receptors. Therefore, RNE could be qualified as a natural immune adjuvant. Finally, we investigated the role of RNE in inflamed cells by using an IL-22 stress. RNE

was able to oppose IL-22 response, at least in cellular proliferation regulation, by restoration of Filaggrin and PTEN expression. As a matter of fact, PTEN major activity is to negatively

downregulate PI3K (phosphatidylinositol-3,4,5-trisphosphate) pathway. PI3K can modulate the activation status of multiple signaling cascades including MAPK, AKT, JNK, ERK, etc.48,49,50,51.

These pathways promote proliferative and uncontrolled cell growth diseases such as cancer and some skin disorders including psoriasis. Hence, our results strongly suggest that RNE modulate

the induced Jak-Stat signaling pathway by upregulating PTEN that leads to PI3K, MAPK and ERK pathways inhibition51. These data were consolidated by the downregulation of BCL-2 that coincides

with PTEN upregulation. For instance, in oral squamous cell carcinomas, tumoregenesis was correlated to the overexpression of BCL-2 and PTEN loss of function. Indeed, the downregulation of

the anti-apoptotic BCL-2 limits proliferation52. Moreover, since it was demonstrated that the simple derivatives of indolo [2,3-a] quinolizinium have the ability to intercalate in the DNA in

a region rich in AT causing proliferation inhibition53, we cannot exclude that RNE, containing such indole alkaloids, could also act via modulating the DNA structure. These exciting

observations open new tracks to pursue non-toxic natural agents endowed with pro-differentiation properties that can be used as a treatment for skin disorders such as psoriasis as well as

uncontrolled IL-22 effects. As a perspective of limiting uncontrolled consumption, we are currently leading experiments to identify the component(s) responsible of these biological

activities. MATERIALS AND METHODS PLANT MATERIAL AND EXTRACTION Bark of _Rauvolfia nukuhivensis_ was collected on at Maauu in “Terre Déserte” area on Nuku Hiva Island located at a Marquesas

archipelago in French Polynesia at an altitude of 477 meters (identified by Dr Jean-François Butaud). A voucher specimen (JFB 2808) has been deposited at the Herbarium of French Polynesia

(PAP, Tahiti Island). After collection at 30 °C, the sample was dried with an air dryer device and stored. The dried bark (50 g) ground into powder, was extracted three times by maceration

with 150 mL EtOH during 16 h at room temperature. Then, the solvent was removed to yield the crude extract that was filtered, concentrated and lyophilized to yield _Rauvolfia nukuhivensis_

extract called RNE (2.1 g). CELL CULTURE AND REAGENTS CELL HANDLING Human keratinocytes HaCaT cells were purchased from AddexBio catalog No. T002000. HaCaT cells were grown Dulbecco’s

Modified Eagle’s Meduim (DMEM), with 4.5 g/L Glucose, with L-Glutamine (Lonza, catalog # BE12-604F) supplemented with 10% fetal bovine serum and 1% Penicillin (10,000Units) –streptomycin (10

 mg) (Sigma-Aldrich, catalog # P0781) at 37 °C with 5% CO2. CELL STIMULATION HaCaT cells were seeded at 2.5 × 105 cells per well of 24 well plate or 6 × 105 cells per well of 6 well plate

for 24 h to get between 50 to 60% of confluency. One-day prior to stimulation, HaCaT cells were starved by replacing the growth medium with DMEM, with 4.5 g/L Glucose, with L-Glutamine

(Lonza, catalog # BE12-604F). Then, the stimulation was achieved in the same medium for 24 h with 200 µg/mL RNE, and/or 0.5 µg/mL Flagellin from _Salmonella enterica_ serovar Typhimurium

(_S_. _Typhimurium_ hereafter) (TLR5 ligand, invivogen catalog # tlrl-stfla) and/or 50 ng/mL recombinant human IL-22 (R&D systems, #782-IL010). CELL METABOLIC ACTIVITY Cell Proliferation

kit II (XTT- Roche) allows to evaluate the cell metabolic activity by assessing the activity of intracellular oxydoreductases. XTT is a colorless or slightly yellow compound that becomes

brightly orange upon reduction by cellular effectors as mitochondrial oxidoreductases. HaCaT cells were seeded in 24 well plates (2.5 × 105 per well) and treated as indicated. XTT assay was

performed according to manufacturer’s instructions. Briefly, XTT solution at a final concentration 0.3 mg/mL was added in each well and the incubation was carried out for 4 h at 37 °C.

During this incubation, the conversion of the yellow tetrazolium salt XTT by viable cells led to the formation of orange formazan solution. The intensity of coloration was quantified by

measuring the absorbance (450 nm) using Victor spectrophotometer (PerkinElmer, Waltham, MA, USA). LDH ASSAY The lactate dehydrogenase (LDH) released upon cell lysis was measured to evaluate

cell cytotoxicity. The CytoTox 96® Non-Radioactive Cytotoxicity Assay (catalog # G1780, promega) was used following the manufacturer’s instructions. Briefly, the LDH test quantifies the

extracellular lactate dehydrogenase. This enzyme located in the cytosol, is found outside the cell in case of necrosis. The test consists of a colorimetric assay of formazan obtained by the

lactate dehydrogenase activity. The ratio of LDH measured in the supernatant over the total LDH (LDH from the supernatant and LDH from the cell lysate), gives the cytotoxic percentage

corresponding to the ratio of secreted LDH × 100. FLOW CYTOMETRIC ANALYSIS FOR KI67 STAINING HaCaT cells were harvested and spun down to a pellet at 300 g for 5 minutes. The cells were

washed with 1 mL of Phosphate Buffered Saline (PBS-1X) (Sigma-Aldrich) and centrifuged at 1500 rpm for 5 minutes. The cells were fixed with 4% _p-_formadehyde at room temperature for 30 

minutes. Then, they were pelleted by centrifugation, resuspended with a permeabilization buffer (50 µL of buffer per 1 × 106 cells). Afterwards, cells were centrifuged and stained with 5 µL

of Alexa Fluor 700 mouse anti-human Ki-67 antibody (BD Pharmingen, #561277) and isotype control (BD Pharmingen, #557882) followed by room temperature incubation for 30 minutes protected from

light. Finally, the cells were washed twice with 2 mL of 0.2% Saponin; resuspended and analyzed with a BD LSR Fortessa Flow Cytometer (BD Biosciences). OXIDATIVE STRESS EVALUATION ROS assay

was achieved by Fluorometric intracellular ROS kit (catalog # MAK143, Sigma-Aldrich) following the manufacturer’s instructions. To evaluate specifically H2O2 amount, Fluorometric Hydrogen

Peroxide kit (catalog # MAK165, Sigma-Aldrich) was used according to the manufacturer’s instructions. _IN VITRO_ KERATINOCYTE WOUND HEALING ASSAY HaCaT cells were grown in a 24 well plate

until a monolayer was formed. Subsequently, the grown cells were starved for 24 h before the performance of a scratch with a 200 µL pipette tip in the middle of the well across two opposite

edges. Thereafter, the cells were gently washed twice with PBS and stimulated as stated above. Finally, the cell migration was followed in real time by video microscopy using a Zeiss

Axiovert 200 M (Carl Zeiss Inc.) fully motorized microscope during 24 hours (scan speed: 1 image every hour). Note that cells were incubated in an atmosphere and temperature controlled

chamber at 37 °C and 5% CO2. Quantitative analysis of the cell free area was performed using the Axiovision Rel. 4.7 (Carl Zeiss Inc.). The level of wound healing across time (up to 96 h)

was evaluated by calculating the percentage of the cell free area at Tx divided by the cell free area at the initial state. RNA EXTRACTION, REVERSE TRANSCRIPTION AND REAL TIME QPCR To obtain

total cDNA from HaCaT cells, total mRNA was extracted using NucleoSpin® RNA XS kit from Macherey-Nagel following the manufacturer’s instructions. The extracted RNA was reverse transcribed

in a two-step protocol using First Strand cDNA Synthesis kit (#K1612) (Thermo Scientific) according to the manufacturer’s instructions. qPCR was carried out with Luna® Universal Probe qPCR

Master Mix (Promega, Catalog # M3004S) in LightCycler 480 (Roche). The relative expression of target genes was measured by the comparative CT (critical threshold) method, normalized to

housekeeping genes β-actin (Forward: GGGCGCCCCAGGCACCAGGT and Reverse: CGTGCTCGATGGGGTACTTC) and GAPDH (Forward: GAAGGTCGGAGTCAACGGATTTG and Reverse: TGGAGGGATCTCGCTCCTGGA) and determined by

the formula 2−ΔΔCT. Primers for target genes were purchased from QuantiTect Primer assay Qiagen (check Table 1) unless for Filaggrin (Forward: CAGCTGACAGGCAAGGGC; Reverse:

CTGTGAGCTCCTACTGCCTG). ENZYME LINKED IMMUNO SORBENT ASSAY To evaluate the inflammatory response, the culture medium was collected from treated keratinocytes and stored at −80 °C. The protein

levels of CXCL-8 and IL-6 were assayed by DuoSet ELISA kit (R&D systems) according to the manufacturer’s instructions. LUCIFERASE REPORTER ASSAYS One-day prior to transfection, HaCaT

cells were seeded onto 24 well plates at 1.5 × 105 cells per well. The next day, cells were around 60% of confluence and thus transfection was performed using PTG1 transfection reagent

(Polytheragene SAS, Evry, France) with 2.5 μg pNF-CMV-luc reporter vector54 at DNA/Polymer weight ratio of 1/6. 4 h after transfection, the medium was replaced with DMEM-High glucose

supplemented with 1% FBS overnight. Then, the cells were treated as mentioned previously. Firefly luciferase gene expression was measured using beetle luciferin (Promega # E1601). Luciferase

activity was normalized to total protein amount using BCA protein assay kit (Interchim, protein quantitation kit, BCAssays, UP40840A). STATISTICAL ANALYSIS All the experiments in the study

were reproduced at least two independent different experiments with n = 3 per group. All data are presented as mean ± SEM. Two-tailed student t-test was used to determine significance

between two groups. Ordinary two-way ANOVA analysis was used to multiple comparisons for more than two groups. _P_-values less than 0.05 were considered significantly different. (*) P < 

0.05, (**) P < 0.01, (***) P < 0.001. DATA AVAILABILITY The datasets generated during the current study are available from the corresponding author on reasonable request. REFERENCES *

Stöckigt, J. Chapter 2: Biosynthesis in Rauwolfia serpentina* Modern Aspects of an Old Medicinal Plant. In _The Alkaloids: Chemistry and Pharmacology_ 47, 115–172 (Academic Press, 1995). *

Vakil, R. J. Rauwolfia serpentina in the treatment of high blood pressure; a review of the literature. _Circulation_ 12, 220–9 (1955). Article  CAS  PubMed  Google Scholar  * Dey, A. &

De, J. N. Rauvolfia serpentina (L). Benth. ex Kurz.-A Review. _Asian J. Plant Sci._ 6, 285–298 (2010). Article  Google Scholar  * Pathania, S., Randhawa, V. & Bagler, G. Prospecting for

Novel Plant-Derived Molecules of Rauvolfia serpentina as Inhibitors of Aldose Reductase, a Potent Drug Target for Diabetes and Its Complications. _PLoS One_ 8, e61327 (2013). Article  ADS 

CAS  PubMed  PubMed Central  Google Scholar  * Girardi, C. _et al_. Herbal medicine in the Marquesas Islands. _J. Ethnopharmacol._ 161, 200–213 (2015). Article  PubMed  Google Scholar  *

Endress, M. E. & Bruyns, P. V. A revised classification of the Apocynaceae s.l. _Bot. Rev._ 66, 1–56 (2000). Article  Google Scholar  * Ganapaty, S., Steve, T. P., Venkata, R. K. &

Neeharika, V. A review of phytochemical studies of Rauwolfia species. _Indian drugs_ 38, 601–612 (2001). CAS  Google Scholar  * Martin, N. J., Prado, S., Lecellier, G., Thomas, O. P. &

Raharivelomanana, P. Nukuhivensiums, indolo[2,3-a]quinoliziniums from the marquesan plant rauvolfia _nukuhivensis_. _Molecules_ 17, 12015–12022 (2012). Article  CAS  PubMed  PubMed Central 

Google Scholar  * Martin, N. J. _et al_. Indole alkaloids from the Marquesan plant Rauvolfia _nukuhivensis_ and their effects on ion channels. _Phytochemistry_ 109, 84–95 (2015). Article 

CAS  PubMed  Google Scholar  * Jost, X., Ansel, J.-L., Lecellier, G., Raharivelomanana, P. & Butaud, J.-F. Ethnobotanical survey of cosmetic plants used in Marquesas Islands (French

Polynesia). _J. Ethnobiol. Ethnomed._ 12, 55 (2016). Article  PubMed  PubMed Central  Google Scholar  * Abdallah, F., Mijouin, L. & Pichon, C. Skin Immune Landscape: Inside and Outside

the Organism. _Mediators Inflamm_. 2017 (2017). * Nestle, F. O., Di Meglio, P., Qin, J.-Z. & Nickoloff, B. J. Skin immune sentinels in health and disease. _Nat. Rev. Immunol._ 9, 679–91

(2009). Article  CAS  PubMed  PubMed Central  Google Scholar  * McKenzie RC, S. D. Keratinocyte cytokines and growth factors. Functions in skin immunity and homeostasis. _Dermal Clin._ 8(4),

649–6 (1990). Article  Google Scholar  * Fulton, C., Anderson, G. M., Zasloff, M., Bull, R. & Quinn, A. G. Expression of natural peptide antibiotics in human skin. _Lancet (London,

England)_ 350, 1750–1 (1997). Article  CAS  Google Scholar  * Lehrer, R. & Ganz, T. Antimicrobial peptides in mammalian and insect host defence. _Curr. Opin. Immunol._ 11, 23–27 (1999).

Article  CAS  PubMed  Google Scholar  * Harder, J., Meyer-Hoffert, U., Wehkamp, K., Schwichtenberg, L. & Schröder, J.-M. Differential Gene Induction of Human β-Defensins (hBD-1, -2, -3,

and -4) in Keratinocytes Is Inhibited by Retinoic Acid. _J. Invest. Dermatol._ 123, 522–529 (2004). Article  CAS  PubMed  Google Scholar  * Harder, J., Bartels, J., Christophers, E. &

Schröder, J.-M. Isolation and Characterization of Human β-Defensin-3, a Novel Human Inducible Peptide Antibiotic. _J. Biol. Chem._ 276, 5707–5713 (2001). Article  CAS  PubMed  Google Scholar

  * Liu, A. Y. _et al_. Human β-Defensin-2 Production in Keratinocytes is Regulated by Interleukin-1, Bacteria, and the State of Differentiation. _J. Invest. Dermatol._ 118, 275–281 (2002).

Article  CAS  PubMed  Google Scholar  * Niyonsaba, F. _et al_. Antimicrobial Peptides Human b-Defensins Stimulate Epidermal Keratinocyte Migration, Proliferation and Production of

Proinflammatory Cytokines and Chemokines. _J. Invest. Dermatol._ 127, 594–604 (2007). Article  CAS  PubMed  Google Scholar  * Lebre, M. C. _et al_. Human keratinocytes express functional

Toll-like receptor 3, 4, 5, and 9. _J Invest Dermatol_ 127, 331–341 (2007). Article  CAS  PubMed  Google Scholar  * Yao, C. _et al_. Toll-like receptor family members in skin fibroblasts are

functional and have a higher expression compared to skin keratinocytes. _Int. J. Mol. Med._ 35, 1443–1450 (2015). Article  CAS  PubMed  Google Scholar  * Olaru, F. & Jensen, L. E.

Chemokine expression by human keratinocyte cell lines after activation of Toll-like receptors. _Experimental Dermatology_ 19, e314–e316 (2010). Article  PubMed  PubMed Central  Google

Scholar  * Gewirtz, A. T., Navas, T. A., Lyons, S., Godowski, P. J. & Madara, J. L. Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial

proinflammatory gene expression. _J. Immunol._ 167, 1882–5 (2001). Article  CAS  PubMed  Google Scholar  * Tallant, T. _et al_. Flagellin acting via TLR5 is the major activator of key

signaling pathways leading to NF-kappa B and proinflammatory gene program activation in intestinal epithelial cells. _BMC Microbiol._ 4, 33 (2004). Article  PubMed  PubMed Central  CAS 

Google Scholar  * Van Maele, L. _et al_. TLR5 Signaling Stimulates the Innate Production of IL-17 and IL-22 by CD3negCD127+ Immune Cells in Spleen and Mucosa. _J. Immunol._ 185, 1177–1185

(2010). Article  PubMed  CAS  Google Scholar  * Boniface, K. _et al_. IL-22 Inhibits Epidermal Differentiation and Induces Proinflammatory Gene Expression and Migration of Human

Keratinocytes. _J. Immunol._ 174, 3695–3702 (2005). Article  CAS  PubMed  Google Scholar  * Wolk, K. _et al_. IL-22 increases the innate immunity of tissues. _Immunity_ 21, 241–254 (2004).

Article  CAS  PubMed  Google Scholar  * Wolk, K. _et al_. IL-22 regulates the expression of genes responsible for antimicrobial defense, cellular differentiation, and mobility in

keratinocytes: A potential role in psoriasis. _Eur. J. Immunol._ 36, 1309–1323 (2006). Article  CAS  PubMed  Google Scholar  * Sabat, R., Ouyang, W. & Wolk, K. Therapeutic opportunities

of the IL-22-IL-22R1 system. _Nat. Rev. Drug Discov._ 13, 21–38 (2014). Article  CAS  PubMed  Google Scholar  * Van Belle, A. B. _et al_. IL-22 Is Required for Imiquimod-Induced Psoriasiform

Skin Inflammation in Mice. _J. Immunol._ 188, 462–469 (2011). Article  PubMed  CAS  Google Scholar  * Fukaya, T. _et al_. Pivotal role of IL-22 binding protein in the epithelial

autoregulation of Interleukin-22 signaling in the control of skin inflammation. _Front. Immunol._ 9, 1418 (2018). Article  PubMed  PubMed Central  CAS  Google Scholar  * Ma, H.-L. _et al_.

IL-22 is required for Th17 cell-mediated pathology in a mouse model of psoriasis-like skin inflammation. _J. Clin. Invest._ 118, 597–607 (2008). CAS  PubMed  PubMed Central  Google Scholar 

* Zenewicz, L. A. & Flavell, R. A. Recent advances in IL-22 biology. _Int. Immunol._ 23, 159–163 (2011). Article  CAS  PubMed  Google Scholar  * Xie, M. H. _et al_. Interleukin (IL-22),

a novel human cytokine that signals through the interferon receptor-related proteins CRF2-4 and IL-22R. _J. Biol. Chem._ 275, 31335–31339 (2000). Article  CAS  PubMed  Google Scholar  *

Kotenko, S. V. _et al_. Identification of the functional interleukin-22 (IL-22) receptor complex: the IL-10R2 chain (IL-10Rbeta) is a common chain of both the IL-10 and IL-22 (IL-10-related

T cell-derived inducible factor, IL-TIF) receptor complexes. _J. Biol. Chem._ 276, 2725–32 (2001). Article  CAS  PubMed  Google Scholar  * Lejeune, D. _et al_. Interleukin-22 (IL-22)

activates the JAK/STAT, ERK, JNK, and p38 MAP kinase pathways in a rat hepatoma cell line. Pathways that are shared with and distinct from IL-10. _J. Biol. Chem._ 277, 33676–82 (2002).

Article  CAS  PubMed  Google Scholar  * Sonnenberg, G. F., Fouser, L. A. & Artis, D. Border patrol: Regulation of immunity, inflammation and tissue homeostasis at barrier surfaces by

IL-22. _Nature Immunology_ 12, 383–390 (2011). Article  CAS  PubMed  Google Scholar  * Sonnenberg, G. F., Fouser, L. A. & Artis, D. Functional Biology of the IL-22-IL-22R Pathway in

Regulating Immunity and Inflammation at Barrier Surfaces. In _Advances in immunology_ 107, 1–29 (2010). Article  CAS  PubMed  Google Scholar  * Aujla, S. J. _et al_. IL-22 mediates mucosal

host defense against Gram-negative bacterial pneumonia. _Nat. Med._ 14, 275–81 (2008). Article  CAS  PubMed  PubMed Central  Google Scholar  * Malhotra, N. _et al_. IL-22 derived from γδ T

cells restricts Staphylococcus aureus infection of mechanically injured skin. _J. Allergy Clin. Immunol._ 138, 1098–1107.e3 (2016). Article  CAS  PubMed  PubMed Central  Google Scholar  *

Zenewicz, L. A. _et al_. Interleukin-22 but not interleukin-17 provides protection to hepatocytes during acute liver inflammation. _Immunity_ 27, 647–59 (2007). Article  CAS  PubMed  PubMed

Central  Google Scholar  * Zenewicz, L. A. _et al_. Innate and adaptive interleukin-22 protects mice from inflammatory bowel disease. _Immunity_ 29, 947–57 (2008). Article  CAS  PubMed 

PubMed Central  Google Scholar  * Lindemans, C. A. _et al_. Interleukin-22 promotes intestinal-stem-cell-mediated epithelial regeneration. _Nature_ 528, 560–564 (2015). Article  ADS  CAS 

PubMed  PubMed Central  Google Scholar  * Dudakov, J. A., Hanash, A. M. & Van Den Brink, M. R. M. Interleukin-22: Immunobiology and Pathology,

https://doi.org/10.1146/annurev-immunol-032414-112123 (2015). * Eyerich, S. _et al_. Th22 cells represent a distinct human T cell subset involved in epidermal immunity and remodeling. _J.

Clin. Invest._ 119, 3573–3585 (2009). CAS  PubMed  PubMed Central  Google Scholar  * Lowes, M. A., Suárez-Fariñas, M. & Krueger, J. G. Immunology of psoriasis. _Annual review of

immunology_ 32, 227–255 (2014). Article  CAS  PubMed  PubMed Central  Google Scholar  * Poupon, E. & Nay, B. _Biomimetic organic synthesis_. (Wiley-VCH, 2011). * Meng, F. _et al_.

MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. _Gastroenterology_ 133, 647–58 (2007). Article  CAS  PubMed  Google Scholar  * Xu, L.-F.

_et al_. MicroRNA-21 (miR-21) regulates cellular proliferation, invasion, migration, and apoptosis by targeting PTEN, RECK and Bcl-2 in lung squamous carcinoma, Gejiu City, China. _PLoS One_

9, e103698 (2014). Article  ADS  PubMed  PubMed Central  CAS  Google Scholar  * Umemura, S. _et al_. Therapeutic priority of the PI3K/AKT/mTOR pathway in small cell lung cancers as revealed

by a comprehensive genomic analysis. _J. Thorac. Oncol._ 9, 1324–31 (2014). Article  CAS  PubMed  PubMed Central  Google Scholar  * Carracedo, A. & Pandolfi, P. P. The PTEN-PI3K

pathway: Of feedbacks and cross-talks. _Oncogene_ 27, 5527–5541 (2008). Article  CAS  PubMed  Google Scholar  * Rahmani, A., Alzohairy, M., Babiker, A. Y., Rizvi, M. A. & Elkarimahmad,

H. G. Clinicopathological significance of PTEN and bcl2 expressions in oral squamous cell carcinoma. _Int. J. Clin. Exp. Pathol._ 5, 965–971 (2012). CAS  PubMed  PubMed Central  Google

Scholar  * Abarca, B. _et al_. Efficient synthesis of an indoloquinolizinium alkaloid selective DNA-binder by ring-closing metathesis. _Org. Lett._ 16, 3464–3467 (2014). Article  CAS  PubMed

  Google Scholar  * Gonçalves, C. _et al_. An optimized extended DNA kappa B site that enhances plasmid DNA nuclear import and gene expression. _J. Gene Med._ 11, 401–411 (2009). Article 

PubMed  CAS  Google Scholar  Download references ACKNOWLEDGEMENTS This project is funded by Région Centre-Val de Loire (Cosmetosciences project, a global training and research program) and

by “Fonds Pacifique” support. FA is the recipient of Cosmetosciences Ph. D grant. We are thankful to Nicolas Martin and J. F. Butaud and French Polynesia DIREN department for sample

collection, plant material identification and helpful discussions. We would like to thank Prof. Joanna Cichy and Ms. Agnieszka Morytko (Jagiellonian University, 31-007 Kraków, Poland) for

seahorse assay and helpful discussion. AUTHOR INFORMATION AUTHORS AND AFFILIATIONS * Centre de Biophysique Moléculaire, CNRS-UPR4301, 45071, Orléans, France Florence Abdallah & Chantal

Pichon * Université de Paris-Saclay UVSQ, 55 Avenue de Paris, 78000, Versailles, France Gaël Lecellier * Université de la Polynésie Française, UMR 241 EIO, 6570 - 98702, Faa’a, Tahiti,

Polynésie Française Phila Raharivelomanana * Université d’Orléans, Collegium Sciences et Techniques, 45100, Orléans, France Chantal Pichon Authors * Florence Abdallah View author

publications You can also search for this author inPubMed Google Scholar * Gaël Lecellier View author publications You can also search for this author inPubMed Google Scholar * Phila

Raharivelomanana View author publications You can also search for this author inPubMed Google Scholar * Chantal Pichon View author publications You can also search for this author inPubMed 

Google Scholar CONTRIBUTIONS Funding acquisition and supervision: C.P. Conceptualization: F.A., P.R., G.L. and C.P. Experimental design: F.A. and C.P. Experimental performance: F.A. All the

authors reviewed the results and approved the final version. CORRESPONDING AUTHOR Correspondence to Chantal Pichon. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing

interests. ADDITIONAL INFORMATION PUBLISHER’S NOTE: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. SUPPLEMENTARY

INFORMATION DATASET 1 RIGHTS AND PERMISSIONS OPEN ACCESS This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation,

distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and

indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to

the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will

need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE

CITE THIS ARTICLE Abdallah, F., Lecellier, G., Raharivelomanana, P. _et al._ _R_. _nukuhivensis_ acts by reinforcing skin barrier function, boosting skin immunity and by inhibiting IL-22

induced keratinocyte hyperproliferation. _Sci Rep_ 9, 4132 (2019). https://doi.org/10.1038/s41598-019-39831-w Download citation * Received: 05 September 2018 * Accepted: 31 January 2019 *

Published: 11 March 2019 * DOI: https://doi.org/10.1038/s41598-019-39831-w SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link

Sorry, a shareable link is not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative