Play all audios:
ABSTRACT _Rauvolfia nukuhivensis_ is a well-known plant used for its wide range of beneficial effects in Marquesas islands. It is made up of diverse indole alkaloids and is used as
traditional medicine for skin application. The actual mechanism behind the virtue of this plant is still unknown. Hence, in this study we aimed at deciphering the impact of _R_.
_nukuhivensis_ on skin immune system in context of (1) homeostasis, (2) pathogen infection and (3) inflammation. Here we show that _R_. _nukuhivensis_ enhances cellular metabolic activity
and wound healing without inducing cellular stress or disturbing cellular homeostasis. It reinforces the epithelial barrier by up-regulating hBD-1. Nevertheless, in pathogenic stress, _R_.
_nukuhivensis_ acts by preparing the immune system to be reactive and effective directly. Indeed, it enhances the innate immune response by increasing pathogens sensors such as TLR5.
Finally, _R_. _nukuhivensis_ blocks IL-22 induced hyperproliferation _via_ PTEN and Filaggrin up-regulation as well as BCL-2 downregulation. In conclusion, this study provides evidence on
the several cutaneous application potentials of _R_. _nukuhivensis_ such as boosting the immune response or in restoring the integrity of the epithelial barrier. SIMILAR CONTENT BEING VIEWED
BY OTHERS PYROMECONIC ACID-ENRICHED _ERIGERON ANNUUS_ WATER EXTRACT AS A COSMETIC INGREDIENT FOR ITCH RELIEF AND ANTI-INFLAMMATORY ACTIVITY Article Open access 26 February 2024
ANTI-INFLAMMATORY AND BARRIER REPAIR MECHANISMS OF ACTIVE COMPONENTS IN _DAEMONOROPS DRACO_ BL. FOR UVB-INDUCED SKIN DAMAGE Article Open access 17 May 2025 IN VITRO PROTECTIVE EFFECTS OF
_PAEONIA OFFICINALIS_ VAR. _MASCULA_ CALLUS EXTRACT ON HUMAN KERATINOCYTES Article Open access 05 November 2020 INTRODUCTION Natural products play an important role in the field of new drugs
research and development. Traditional medicine has a long history of serving civilization all over the world. Ancient ancestry believed that a disease has a natural cause, so natural herbal
remedies can treat it. It is only from 19th century that researchers started to isolate the active principle from medicinal plants that became important clinical agents such as ajmalicine
and reserpine used for hypertension treatment1,2,3,4,5. _Rauvolfia_ is a genus of the _Apocynaceae_ family characterized by their indole composition6,7,8,9. _Rauvolfia_ genus includes more
than 100 species that are native to tropical and subtropical regions of the world. _R_. _nukuhivensis_ is one of these endemic species that belong to the Marquesas archipelago from French
Polynesia. In traditional medicine, the extracts of this flowering plant are still excessively used for skin issues namely for women intimate care and wound healing5,10. The absence of
scientific explanation of the plant virtues resulted in its uncontrolled usage that critically endangered this species. In fact, the biological characterization of _R_. _nukuhivensis_
extract (RNE) is essential to limit its extinction and to comprehend its impact on the cutaneous physiological-immunological mechanisms. Therefore, this study aimed at defining the role of
RNE in skin biology by studying its impact on the skin immune system from cellular activities to innate immune responses in homeostasis, in pathogenic stress and in inflammation. The study
was performed on keratinocytes (KCs) which constitute over 95% of the epidermal cell type and are the first sensors of pathogen invasion11,12. Moreover, the skin contains a highly dynamic
immune system that is dependent on a cross-talk between KCs and other sentinels of the immune system11. This connected network is governed by KCs that are in constant contact with the
external environments ensuring skin barrier function and defense mechanisms for homeostasis maintenance. Hence, different cutaneous components are mobilized to preserve the skin integrity
through innate immunity, which is the most active and effective actor against daily life external insults challenges13. To face that, the skin renews itself each month ensuring by that skin
restoration, rejuvenation and reepithelization. This process involves a complex interplay between several cutaneous innate and adaptive actors such as antimicrobial peptides (AMPs),
inflammatory mediators and proliferative cytokines such as IL-22. For instance, AMPs generation by the innate immune system is essential for epithelial barrier preservation14. In human,
β-defensins (hBD) have been identified in skin and constitute the most expressed AMPs15. Four types of cutaneous β-defensins (hBD-1, 2, 3 and 4) are differentially expressed either in
constitutive or inducible manner16. hBD-1 constitutively expressed in keratinocytes is responsible of cutaneous immunosurveillance. However, hBD-2 and hBD-3 are induced upon pathogens
invasion and inflammation17,18,19. When the skin is challenged with pathogens, an inflammatory response is mediated by the innate immune system to clear and neutralize them. This pathogen
invasion danger is sensed by KCs via their innate receptors such as TLRs enabling innate inflammatory pathways activation. TLR5 is one of the most expressed receptor on KCs surface20,21.
Indeed, it is activated by Flagellin which is the major constituent of bacterial flagella. The subsequent activation results in NF-κB signaling leading to increased proinflammatory mediators
such as CXCL-8, IL-6 and IL-2222,23,24,25. In some cases, this response becomes uncontrolled and causes cellular processes perturbations resulting in inflamed epidermis. In fact, several
skin disorders are characterized by unbalanced KCs proliferation and differentiation caused by increased inflammatory environment enriched by IL-22. This key cytokine acts as a shuttle
between leukocytes and epithelia in non-hematopoietic cells at body barriers including epithelial cells of the lung, gastrointestinal tract and KCs in the skin26,27,28. Nevertheless,
continuous exacerbated or uncontrolled IL-22 signaling leads to undesirable tissue inflammation, accelerating certain immune pathologies such as psoriasis, atopic dermatitis and rheumatoid
arthritis29,30,31,32. IL-22 belongs to IL-10 family and is mainly produced by CD4+ effector T (Teff) cells as well as innate lymphoid cells 3 (ILC3)33. It signals through the IL-22R1/IL-10R2
complex and subsequent JAK–signal transducer, activator of transcription (STAT) signaling pathways (anti-apoptosis, cell cycle, differentiation…) and the mitogen-activating peptide kinase
pathway34,35,36. So, IL-22 has an important role in the maintenance of epithelial integrity at barrier surfaces37,38. Its main physiological job includes reinforcement of epithelium barrier
function through induction of hBD-2 and hBD-3 in context of infection14,17,18,19,26,27,39,40, wound healing through promotion of epithelial cell proliferation and survival following tissue
damage in pathophysiological conditions41,42,43. Hence, the fine-tuning of IL-22 signaling implicated in these processes can be beneficial to treat skin disorders. The aim of the study is to
define the impact of RNE on skin innate immunity in homeostatic and non-homeostatic conditions. To this purpose, we first evaluated the cellular stress induced by RNE through cytotoxicity
and oxidative tests. Then, we looked at the wound healing properties by following wound closure over time and skin barrier functions by defining the relative expression of genes belonging to
β-defensins family. We assessed the impact of the extract on skin inflammatory response using a variety of assays. Last but not least, we investigated the role of RNE in IL-22 induced
proliferation by evaluating gene expression implicated in proliferation processes which are deregulated by IL-22 stimulation. RESULTS RNE ENHANCES WOUND-HEALING PROPERTIES WITHOUT DISTURBING
CELLULAR PROCESSES The first challenge was to define the non-cytotoxic effective concentration of RNE to be used since the extract is composed of alkaloids that can be toxic for the cells.
Thus, we achieved a kinetic of a dose-response experiment that showed the absence of cytotoxicity and enhanced viability profile below 300 µg/mL for cells treated during 24 h and 48 h (see
supplementary Fig. S1). For this study, the concentration of 200 µg/mL was chosen and used throughout the experiments. Then, we investigated the impact of RNE on cellular processes in steady
state condition. We checked the metabolic activity by an XTT assay, cellular cytotoxicity by an LDH assay, cellular proliferation by a Ki67 staining, and oxidative stress by ROS and H2O2
production. The stimulation of HaCaT with RNE for 24 h didn’t have any cytotoxicity effects (Fig. 1). However, a significant increase (around 40%) of the metabolic activity was recorded
compared to unstimulated cells (Fig. 1b). Yet, the percentage of Ki67 positive cells was similar in presence or absence of RNE (Fig. 1c). Hence, to verify if RNE causes any cellular stress,
we performed a seahorse test that consists of quantifying different parameters of mitochondrial respiration. The seahorse test showed a similar profile between untreated and RNE treated
HaCaT confirming by that the absence of mitochondrial dysfunction (See supplementary Fig. S2). Similarly, RNE failed to induce ROS and H2O2 production showing the absence of an oxidative
stress (Fig. 1d,e). Since Polynesian people use RNE to treat skin wounds, we performed a wound-healing assay. One essential step of the healing process is the epithelialization ensured by
cell migration, which is the major read out of this assay. HaCaT stimulated with RNE showed a significant increase of keratinocyte migration into the cell free area resulting in almost
complete recovery at 92 h compared to unstimulated cells (Fig. 2a). RNE application resulted in 30% wound closure improvement with respect to untreated cells (Fig. 2b). RNE IMPACTS ON
DEFENSIN GENE EXPRESSION AND INFLAMMATORY CYTOKINE SECRETION Here, we investigated the effect of RNE on β-defensins mRNA expression (Fig. 3). HaCaT were incubated with RNE for 24 h and gene
expression was analyzed using real-time qPCR. The results revealed a significant increase of 6.2-fold for the constitutive hBD-1 (Fig. 3a) whereas a decreased tendency profile (~2-fold) for
the inducible hBD-2 and hBD-3 (Fig. 3b,c) was observed. The traditional usage of _R_. _nukuhivensis_ to treat cutaneous infections prompted us to study its impact on inflammatory response in
presence of Flagellin (TLR5 agonist) a well-characterized inflammatory pathway in KCs. To this aim, KCs were stimulated with 0.5 μg/mL Flagellin in presence or absence of RNE during 24 h.
Then, TLR5 mRNA expression was measured by RT-qPCR and CXCL-8 and IL-6 secretion were assessed by ELISA. TLR5 gene relative expression was increased by 2-fold for 0.5 μg/mL Flagellin treated
KCs whereas 3-fold increase was observed for RNE treated KCs compared to control (Fig. 4b). Nevertheless, the co-stimulation of KCs with Flagellin and RNE resulted in the highest
up-regulation that reached a 4-fold increase compared to basal expression (Fig. 4a). Accordingly, the evaluation of inflammatory mediators showed a significant increased production of CXCL-8
and IL-6 upon Flagellin stimulation while RNE stimulation didn’t induce cytokine production (Fig. 4c,d). The co-stimulation Flagellin with RNE resulted in the highest CXCL-8 and IL-6
production (Fig. 4c,d). Finally, the activation of NF-κB was assayed to confirm these observations since TLR5 stimulation leads to NF-κB import inside the nucleus where it acts as
transcription factor (Fig. 4a). For that, we took use of NF-κB luciferase reporter assay to monitor the activation of NF-κB. KCs were transfected with pNF-CMV-luc reporter vector prior to
stimulation with either Flagellin alone, RNE alone or with both. Enhancement of luciferase activity was observed in Flagellin but not RNE stimulated KCs indicating the activation of NF-κB
pathway in case of Flagellin application and confirming the absence of RNE induced NF-κB dependent stress. In accordance with the previous obtained results, the co-stimulation resulted in
the highest significant (~two fold) luciferase activity compared to Flagellin simulation alone (Fig. 5). RNE IS A NATURAL ANTIPROLIFERATIVE AGENT To further study the impact of _R_.
_nukuhivensis_ in skin, we thought to investigate its possible activity in inflamed hyperproliferative skin. IL-22 cytokine, an IL-10 family member up regulated in skin disorders such as
psoriasis and atopic dermatitis, was used to stress keratinocytes. Indeed, IL-22 is known to induce KCs hyper-proliferation and to inhibit KCs differentiation26,44,45,46. First, we checked
whether the stimulation of KCs with either 50 ng/mL IL-22 alone, RNE alone or co-stimulation with both compounds did induce any cytotoxicity. The LDH assay showed same profile between the
different conditions and non-treated cells indicating the absence of cytotoxicity (Fig. 6a). Then, we measured the mRNA levels of PTEN the negative regulator of cellular proliferation,
Filaggrin the differentiation marker known to be downregulated in presence of IL-22 and BCL-2 the anti-apoptotic molecule. Accordingly, we showed that IL-22 stimulation resulted in their
down-regulation whereas RNE stimulation alone didn’t impact their expression. However, in same experimental conditions, the co-stimulation resulted in PTEN and Filaggrin expression
restoration and BCL-2 downregulation (Fig. 6b–d). All these data point the ability of _R_. _nukuhivensis_ to limit IL-22 induced uncontrolled proliferation. DISCUSSION The aim of this study
is to comprehend the impact of RNE on skin in several contexts. To date, the medicinal cutaneous virtue of this plant remains unknown. In the 50’s Sheuer’s group isolated many alkaloids
including serpentinin, ajmaline, sandwicine, sandwicencine, tetraphylline, tetraphyllicin and mauiensine from _Rauvolfia_ genus47. Alkaloids belonging to the family of Ajmalines common to
the genus _Rauvolfia_ are exploited in pharmacology due to their anti-arrhythmic, anti-depressive, anti-oxidant and anti-tumoral activities. From _R_. _nukuhivensis_, we isolated derivatives
of indolo [2,3-a] quinolizinium (nukuhivensium and N12-methyl-nukuhivensium) and demonstrated their anti-arrhythmic activity, by their action on the hERG potassium channel8,9. Despite these
biological effects, no study addresses the impact of this plant extract on skin that is highly used by locals. This prompted us to investigate the biological effects induced by RNE
stimulation in human keratinocytes. The first set of data indicates that 24 hours cell stimulation with RNE was not harmful but led to an increased metabolic activity; though the
proliferation was not disturbed with any detectable mitochondrial stress. Interestingly, RNE exhibits healing properties since cell treatment with the extract resulted in significant
improved wound closure compared to untreated cells. This is likely due to keratinocytes migration, as the RNE treatment did not increase the cell proliferation compare to untreated cells as
shown by the negative Ki-67 test. Interestingly, this extract did also improve the wound healing of fibroblasts monolayer (data not shown). All these data highlight that this plant extract
has a great potential as ingredient in anti-aging products and treatments by its cellular remodeling effect without disturbing major viability cellular processes. Marquesan women use RNE as
an intimate care, which sounds antimicrobial, or antiseptic-like agent. Previous works showed that this extract lacks of direct antimicrobial activity against the _Candida albicans_,
_Aspergillus niger_, _Escherichia coli and Staphylococcus aureus_ microorganisms8. This prompted us to study nevertheless the impact of RNE on skin barrier function by looking at defensins
expression known to be major contributors in innate immunity and immunosurveillance. Our data clearly showed the ability of RNE to upregulate significantly hBD-1, which is expressed
constitutively in the terminal layer of the skin and ensures cutaneous immunosurveillance. The inducible hBD-2 and hBD-3 were slightly down-regulated. Hence, RNE reinforces the epithelial
barrier by increasing the immunosurveillance defensin rather than the proinflammatory inducible defensins. This result suggested that RNE influences the background regulation of KCs without
inducing an immune-associated response. To go further, we assessed the impact of RNE on the innate immune system. Under normal conditions, RNE up-regulated TLR5 gene expression but did not
induce the usual chemokine (CXCL-8) and cytokine (IL-6) production enhanced in response to external pathogens stimuli. Moreover, in presence of an external stress such as the TLR5 agonist
Flagellin, RNE strengthened the immune response. This led to a more potent and immediate innate immune response via increased chemokine and cytokine production (e.g CXCL-8 and IL-6) in NF-κB
dependent manner. To sum up, RNE seems to act by preparing the immune system of KCs to be more reactive and effective immediately through enhancing its innate immune response by increasing
the amount of Toll-like receptors. Therefore, RNE could be qualified as a natural immune adjuvant. Finally, we investigated the role of RNE in inflamed cells by using an IL-22 stress. RNE
was able to oppose IL-22 response, at least in cellular proliferation regulation, by restoration of Filaggrin and PTEN expression. As a matter of fact, PTEN major activity is to negatively
downregulate PI3K (phosphatidylinositol-3,4,5-trisphosphate) pathway. PI3K can modulate the activation status of multiple signaling cascades including MAPK, AKT, JNK, ERK, etc.48,49,50,51.
These pathways promote proliferative and uncontrolled cell growth diseases such as cancer and some skin disorders including psoriasis. Hence, our results strongly suggest that RNE modulate
the induced Jak-Stat signaling pathway by upregulating PTEN that leads to PI3K, MAPK and ERK pathways inhibition51. These data were consolidated by the downregulation of BCL-2 that coincides
with PTEN upregulation. For instance, in oral squamous cell carcinomas, tumoregenesis was correlated to the overexpression of BCL-2 and PTEN loss of function. Indeed, the downregulation of
the anti-apoptotic BCL-2 limits proliferation52. Moreover, since it was demonstrated that the simple derivatives of indolo [2,3-a] quinolizinium have the ability to intercalate in the DNA in
a region rich in AT causing proliferation inhibition53, we cannot exclude that RNE, containing such indole alkaloids, could also act via modulating the DNA structure. These exciting
observations open new tracks to pursue non-toxic natural agents endowed with pro-differentiation properties that can be used as a treatment for skin disorders such as psoriasis as well as
uncontrolled IL-22 effects. As a perspective of limiting uncontrolled consumption, we are currently leading experiments to identify the component(s) responsible of these biological
activities. MATERIALS AND METHODS PLANT MATERIAL AND EXTRACTION Bark of _Rauvolfia nukuhivensis_ was collected on at Maauu in “Terre Déserte” area on Nuku Hiva Island located at a Marquesas
archipelago in French Polynesia at an altitude of 477 meters (identified by Dr Jean-François Butaud). A voucher specimen (JFB 2808) has been deposited at the Herbarium of French Polynesia
(PAP, Tahiti Island). After collection at 30 °C, the sample was dried with an air dryer device and stored. The dried bark (50 g) ground into powder, was extracted three times by maceration
with 150 mL EtOH during 16 h at room temperature. Then, the solvent was removed to yield the crude extract that was filtered, concentrated and lyophilized to yield _Rauvolfia nukuhivensis_
extract called RNE (2.1 g). CELL CULTURE AND REAGENTS CELL HANDLING Human keratinocytes HaCaT cells were purchased from AddexBio catalog No. T002000. HaCaT cells were grown Dulbecco’s
Modified Eagle’s Meduim (DMEM), with 4.5 g/L Glucose, with L-Glutamine (Lonza, catalog # BE12-604F) supplemented with 10% fetal bovine serum and 1% Penicillin (10,000Units) –streptomycin (10
mg) (Sigma-Aldrich, catalog # P0781) at 37 °C with 5% CO2. CELL STIMULATION HaCaT cells were seeded at 2.5 × 105 cells per well of 24 well plate or 6 × 105 cells per well of 6 well plate
for 24 h to get between 50 to 60% of confluency. One-day prior to stimulation, HaCaT cells were starved by replacing the growth medium with DMEM, with 4.5 g/L Glucose, with L-Glutamine
(Lonza, catalog # BE12-604F). Then, the stimulation was achieved in the same medium for 24 h with 200 µg/mL RNE, and/or 0.5 µg/mL Flagellin from _Salmonella enterica_ serovar Typhimurium
(_S_. _Typhimurium_ hereafter) (TLR5 ligand, invivogen catalog # tlrl-stfla) and/or 50 ng/mL recombinant human IL-22 (R&D systems, #782-IL010). CELL METABOLIC ACTIVITY Cell Proliferation
kit II (XTT- Roche) allows to evaluate the cell metabolic activity by assessing the activity of intracellular oxydoreductases. XTT is a colorless or slightly yellow compound that becomes
brightly orange upon reduction by cellular effectors as mitochondrial oxidoreductases. HaCaT cells were seeded in 24 well plates (2.5 × 105 per well) and treated as indicated. XTT assay was
performed according to manufacturer’s instructions. Briefly, XTT solution at a final concentration 0.3 mg/mL was added in each well and the incubation was carried out for 4 h at 37 °C.
During this incubation, the conversion of the yellow tetrazolium salt XTT by viable cells led to the formation of orange formazan solution. The intensity of coloration was quantified by
measuring the absorbance (450 nm) using Victor spectrophotometer (PerkinElmer, Waltham, MA, USA). LDH ASSAY The lactate dehydrogenase (LDH) released upon cell lysis was measured to evaluate
cell cytotoxicity. The CytoTox 96® Non-Radioactive Cytotoxicity Assay (catalog # G1780, promega) was used following the manufacturer’s instructions. Briefly, the LDH test quantifies the
extracellular lactate dehydrogenase. This enzyme located in the cytosol, is found outside the cell in case of necrosis. The test consists of a colorimetric assay of formazan obtained by the
lactate dehydrogenase activity. The ratio of LDH measured in the supernatant over the total LDH (LDH from the supernatant and LDH from the cell lysate), gives the cytotoxic percentage
corresponding to the ratio of secreted LDH × 100. FLOW CYTOMETRIC ANALYSIS FOR KI67 STAINING HaCaT cells were harvested and spun down to a pellet at 300 g for 5 minutes. The cells were
washed with 1 mL of Phosphate Buffered Saline (PBS-1X) (Sigma-Aldrich) and centrifuged at 1500 rpm for 5 minutes. The cells were fixed with 4% _p-_formadehyde at room temperature for 30
minutes. Then, they were pelleted by centrifugation, resuspended with a permeabilization buffer (50 µL of buffer per 1 × 106 cells). Afterwards, cells were centrifuged and stained with 5 µL
of Alexa Fluor 700 mouse anti-human Ki-67 antibody (BD Pharmingen, #561277) and isotype control (BD Pharmingen, #557882) followed by room temperature incubation for 30 minutes protected from
light. Finally, the cells were washed twice with 2 mL of 0.2% Saponin; resuspended and analyzed with a BD LSR Fortessa Flow Cytometer (BD Biosciences). OXIDATIVE STRESS EVALUATION ROS assay
was achieved by Fluorometric intracellular ROS kit (catalog # MAK143, Sigma-Aldrich) following the manufacturer’s instructions. To evaluate specifically H2O2 amount, Fluorometric Hydrogen
Peroxide kit (catalog # MAK165, Sigma-Aldrich) was used according to the manufacturer’s instructions. _IN VITRO_ KERATINOCYTE WOUND HEALING ASSAY HaCaT cells were grown in a 24 well plate
until a monolayer was formed. Subsequently, the grown cells were starved for 24 h before the performance of a scratch with a 200 µL pipette tip in the middle of the well across two opposite
edges. Thereafter, the cells were gently washed twice with PBS and stimulated as stated above. Finally, the cell migration was followed in real time by video microscopy using a Zeiss
Axiovert 200 M (Carl Zeiss Inc.) fully motorized microscope during 24 hours (scan speed: 1 image every hour). Note that cells were incubated in an atmosphere and temperature controlled
chamber at 37 °C and 5% CO2. Quantitative analysis of the cell free area was performed using the Axiovision Rel. 4.7 (Carl Zeiss Inc.). The level of wound healing across time (up to 96 h)
was evaluated by calculating the percentage of the cell free area at Tx divided by the cell free area at the initial state. RNA EXTRACTION, REVERSE TRANSCRIPTION AND REAL TIME QPCR To obtain
total cDNA from HaCaT cells, total mRNA was extracted using NucleoSpin® RNA XS kit from Macherey-Nagel following the manufacturer’s instructions. The extracted RNA was reverse transcribed
in a two-step protocol using First Strand cDNA Synthesis kit (#K1612) (Thermo Scientific) according to the manufacturer’s instructions. qPCR was carried out with Luna® Universal Probe qPCR
Master Mix (Promega, Catalog # M3004S) in LightCycler 480 (Roche). The relative expression of target genes was measured by the comparative CT (critical threshold) method, normalized to
housekeeping genes β-actin (Forward: GGGCGCCCCAGGCACCAGGT and Reverse: CGTGCTCGATGGGGTACTTC) and GAPDH (Forward: GAAGGTCGGAGTCAACGGATTTG and Reverse: TGGAGGGATCTCGCTCCTGGA) and determined by
the formula 2−ΔΔCT. Primers for target genes were purchased from QuantiTect Primer assay Qiagen (check Table 1) unless for Filaggrin (Forward: CAGCTGACAGGCAAGGGC; Reverse:
CTGTGAGCTCCTACTGCCTG). ENZYME LINKED IMMUNO SORBENT ASSAY To evaluate the inflammatory response, the culture medium was collected from treated keratinocytes and stored at −80 °C. The protein
levels of CXCL-8 and IL-6 were assayed by DuoSet ELISA kit (R&D systems) according to the manufacturer’s instructions. LUCIFERASE REPORTER ASSAYS One-day prior to transfection, HaCaT
cells were seeded onto 24 well plates at 1.5 × 105 cells per well. The next day, cells were around 60% of confluence and thus transfection was performed using PTG1 transfection reagent
(Polytheragene SAS, Evry, France) with 2.5 μg pNF-CMV-luc reporter vector54 at DNA/Polymer weight ratio of 1/6. 4 h after transfection, the medium was replaced with DMEM-High glucose
supplemented with 1% FBS overnight. Then, the cells were treated as mentioned previously. Firefly luciferase gene expression was measured using beetle luciferin (Promega # E1601). Luciferase
activity was normalized to total protein amount using BCA protein assay kit (Interchim, protein quantitation kit, BCAssays, UP40840A). STATISTICAL ANALYSIS All the experiments in the study
were reproduced at least two independent different experiments with n = 3 per group. All data are presented as mean ± SEM. Two-tailed student t-test was used to determine significance
between two groups. Ordinary two-way ANOVA analysis was used to multiple comparisons for more than two groups. _P_-values less than 0.05 were considered significantly different. (*) P <
0.05, (**) P < 0.01, (***) P < 0.001. DATA AVAILABILITY The datasets generated during the current study are available from the corresponding author on reasonable request. REFERENCES *
Stöckigt, J. Chapter 2: Biosynthesis in Rauwolfia serpentina* Modern Aspects of an Old Medicinal Plant. In _The Alkaloids: Chemistry and Pharmacology_ 47, 115–172 (Academic Press, 1995). *
Vakil, R. J. Rauwolfia serpentina in the treatment of high blood pressure; a review of the literature. _Circulation_ 12, 220–9 (1955). Article CAS PubMed Google Scholar * Dey, A. &
De, J. N. Rauvolfia serpentina (L). Benth. ex Kurz.-A Review. _Asian J. Plant Sci._ 6, 285–298 (2010). Article Google Scholar * Pathania, S., Randhawa, V. & Bagler, G. Prospecting for
Novel Plant-Derived Molecules of Rauvolfia serpentina as Inhibitors of Aldose Reductase, a Potent Drug Target for Diabetes and Its Complications. _PLoS One_ 8, e61327 (2013). Article ADS
CAS PubMed PubMed Central Google Scholar * Girardi, C. _et al_. Herbal medicine in the Marquesas Islands. _J. Ethnopharmacol._ 161, 200–213 (2015). Article PubMed Google Scholar *
Endress, M. E. & Bruyns, P. V. A revised classification of the Apocynaceae s.l. _Bot. Rev._ 66, 1–56 (2000). Article Google Scholar * Ganapaty, S., Steve, T. P., Venkata, R. K. &
Neeharika, V. A review of phytochemical studies of Rauwolfia species. _Indian drugs_ 38, 601–612 (2001). CAS Google Scholar * Martin, N. J., Prado, S., Lecellier, G., Thomas, O. P. &
Raharivelomanana, P. Nukuhivensiums, indolo[2,3-a]quinoliziniums from the marquesan plant rauvolfia _nukuhivensis_. _Molecules_ 17, 12015–12022 (2012). Article CAS PubMed PubMed Central
Google Scholar * Martin, N. J. _et al_. Indole alkaloids from the Marquesan plant Rauvolfia _nukuhivensis_ and their effects on ion channels. _Phytochemistry_ 109, 84–95 (2015). Article
CAS PubMed Google Scholar * Jost, X., Ansel, J.-L., Lecellier, G., Raharivelomanana, P. & Butaud, J.-F. Ethnobotanical survey of cosmetic plants used in Marquesas Islands (French
Polynesia). _J. Ethnobiol. Ethnomed._ 12, 55 (2016). Article PubMed PubMed Central Google Scholar * Abdallah, F., Mijouin, L. & Pichon, C. Skin Immune Landscape: Inside and Outside
the Organism. _Mediators Inflamm_. 2017 (2017). * Nestle, F. O., Di Meglio, P., Qin, J.-Z. & Nickoloff, B. J. Skin immune sentinels in health and disease. _Nat. Rev. Immunol._ 9, 679–91
(2009). Article CAS PubMed PubMed Central Google Scholar * McKenzie RC, S. D. Keratinocyte cytokines and growth factors. Functions in skin immunity and homeostasis. _Dermal Clin._ 8(4),
649–6 (1990). Article Google Scholar * Fulton, C., Anderson, G. M., Zasloff, M., Bull, R. & Quinn, A. G. Expression of natural peptide antibiotics in human skin. _Lancet (London,
England)_ 350, 1750–1 (1997). Article CAS Google Scholar * Lehrer, R. & Ganz, T. Antimicrobial peptides in mammalian and insect host defence. _Curr. Opin. Immunol._ 11, 23–27 (1999).
Article CAS PubMed Google Scholar * Harder, J., Meyer-Hoffert, U., Wehkamp, K., Schwichtenberg, L. & Schröder, J.-M. Differential Gene Induction of Human β-Defensins (hBD-1, -2, -3,
and -4) in Keratinocytes Is Inhibited by Retinoic Acid. _J. Invest. Dermatol._ 123, 522–529 (2004). Article CAS PubMed Google Scholar * Harder, J., Bartels, J., Christophers, E. &
Schröder, J.-M. Isolation and Characterization of Human β-Defensin-3, a Novel Human Inducible Peptide Antibiotic. _J. Biol. Chem._ 276, 5707–5713 (2001). Article CAS PubMed Google Scholar
* Liu, A. Y. _et al_. Human β-Defensin-2 Production in Keratinocytes is Regulated by Interleukin-1, Bacteria, and the State of Differentiation. _J. Invest. Dermatol._ 118, 275–281 (2002).
Article CAS PubMed Google Scholar * Niyonsaba, F. _et al_. Antimicrobial Peptides Human b-Defensins Stimulate Epidermal Keratinocyte Migration, Proliferation and Production of
Proinflammatory Cytokines and Chemokines. _J. Invest. Dermatol._ 127, 594–604 (2007). Article CAS PubMed Google Scholar * Lebre, M. C. _et al_. Human keratinocytes express functional
Toll-like receptor 3, 4, 5, and 9. _J Invest Dermatol_ 127, 331–341 (2007). Article CAS PubMed Google Scholar * Yao, C. _et al_. Toll-like receptor family members in skin fibroblasts are
functional and have a higher expression compared to skin keratinocytes. _Int. J. Mol. Med._ 35, 1443–1450 (2015). Article CAS PubMed Google Scholar * Olaru, F. & Jensen, L. E.
Chemokine expression by human keratinocyte cell lines after activation of Toll-like receptors. _Experimental Dermatology_ 19, e314–e316 (2010). Article PubMed PubMed Central Google
Scholar * Gewirtz, A. T., Navas, T. A., Lyons, S., Godowski, P. J. & Madara, J. L. Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial
proinflammatory gene expression. _J. Immunol._ 167, 1882–5 (2001). Article CAS PubMed Google Scholar * Tallant, T. _et al_. Flagellin acting via TLR5 is the major activator of key
signaling pathways leading to NF-kappa B and proinflammatory gene program activation in intestinal epithelial cells. _BMC Microbiol._ 4, 33 (2004). Article PubMed PubMed Central CAS
Google Scholar * Van Maele, L. _et al_. TLR5 Signaling Stimulates the Innate Production of IL-17 and IL-22 by CD3negCD127+ Immune Cells in Spleen and Mucosa. _J. Immunol._ 185, 1177–1185
(2010). Article PubMed CAS Google Scholar * Boniface, K. _et al_. IL-22 Inhibits Epidermal Differentiation and Induces Proinflammatory Gene Expression and Migration of Human
Keratinocytes. _J. Immunol._ 174, 3695–3702 (2005). Article CAS PubMed Google Scholar * Wolk, K. _et al_. IL-22 increases the innate immunity of tissues. _Immunity_ 21, 241–254 (2004).
Article CAS PubMed Google Scholar * Wolk, K. _et al_. IL-22 regulates the expression of genes responsible for antimicrobial defense, cellular differentiation, and mobility in
keratinocytes: A potential role in psoriasis. _Eur. J. Immunol._ 36, 1309–1323 (2006). Article CAS PubMed Google Scholar * Sabat, R., Ouyang, W. & Wolk, K. Therapeutic opportunities
of the IL-22-IL-22R1 system. _Nat. Rev. Drug Discov._ 13, 21–38 (2014). Article CAS PubMed Google Scholar * Van Belle, A. B. _et al_. IL-22 Is Required for Imiquimod-Induced Psoriasiform
Skin Inflammation in Mice. _J. Immunol._ 188, 462–469 (2011). Article PubMed CAS Google Scholar * Fukaya, T. _et al_. Pivotal role of IL-22 binding protein in the epithelial
autoregulation of Interleukin-22 signaling in the control of skin inflammation. _Front. Immunol._ 9, 1418 (2018). Article PubMed PubMed Central CAS Google Scholar * Ma, H.-L. _et al_.
IL-22 is required for Th17 cell-mediated pathology in a mouse model of psoriasis-like skin inflammation. _J. Clin. Invest._ 118, 597–607 (2008). CAS PubMed PubMed Central Google Scholar
* Zenewicz, L. A. & Flavell, R. A. Recent advances in IL-22 biology. _Int. Immunol._ 23, 159–163 (2011). Article CAS PubMed Google Scholar * Xie, M. H. _et al_. Interleukin (IL-22),
a novel human cytokine that signals through the interferon receptor-related proteins CRF2-4 and IL-22R. _J. Biol. Chem._ 275, 31335–31339 (2000). Article CAS PubMed Google Scholar *
Kotenko, S. V. _et al_. Identification of the functional interleukin-22 (IL-22) receptor complex: the IL-10R2 chain (IL-10Rbeta) is a common chain of both the IL-10 and IL-22 (IL-10-related
T cell-derived inducible factor, IL-TIF) receptor complexes. _J. Biol. Chem._ 276, 2725–32 (2001). Article CAS PubMed Google Scholar * Lejeune, D. _et al_. Interleukin-22 (IL-22)
activates the JAK/STAT, ERK, JNK, and p38 MAP kinase pathways in a rat hepatoma cell line. Pathways that are shared with and distinct from IL-10. _J. Biol. Chem._ 277, 33676–82 (2002).
Article CAS PubMed Google Scholar * Sonnenberg, G. F., Fouser, L. A. & Artis, D. Border patrol: Regulation of immunity, inflammation and tissue homeostasis at barrier surfaces by
IL-22. _Nature Immunology_ 12, 383–390 (2011). Article CAS PubMed Google Scholar * Sonnenberg, G. F., Fouser, L. A. & Artis, D. Functional Biology of the IL-22-IL-22R Pathway in
Regulating Immunity and Inflammation at Barrier Surfaces. In _Advances in immunology_ 107, 1–29 (2010). Article CAS PubMed Google Scholar * Aujla, S. J. _et al_. IL-22 mediates mucosal
host defense against Gram-negative bacterial pneumonia. _Nat. Med._ 14, 275–81 (2008). Article CAS PubMed PubMed Central Google Scholar * Malhotra, N. _et al_. IL-22 derived from γδ T
cells restricts Staphylococcus aureus infection of mechanically injured skin. _J. Allergy Clin. Immunol._ 138, 1098–1107.e3 (2016). Article CAS PubMed PubMed Central Google Scholar *
Zenewicz, L. A. _et al_. Interleukin-22 but not interleukin-17 provides protection to hepatocytes during acute liver inflammation. _Immunity_ 27, 647–59 (2007). Article CAS PubMed PubMed
Central Google Scholar * Zenewicz, L. A. _et al_. Innate and adaptive interleukin-22 protects mice from inflammatory bowel disease. _Immunity_ 29, 947–57 (2008). Article CAS PubMed
PubMed Central Google Scholar * Lindemans, C. A. _et al_. Interleukin-22 promotes intestinal-stem-cell-mediated epithelial regeneration. _Nature_ 528, 560–564 (2015). Article ADS CAS
PubMed PubMed Central Google Scholar * Dudakov, J. A., Hanash, A. M. & Van Den Brink, M. R. M. Interleukin-22: Immunobiology and Pathology,
https://doi.org/10.1146/annurev-immunol-032414-112123 (2015). * Eyerich, S. _et al_. Th22 cells represent a distinct human T cell subset involved in epidermal immunity and remodeling. _J.
Clin. Invest._ 119, 3573–3585 (2009). CAS PubMed PubMed Central Google Scholar * Lowes, M. A., Suárez-Fariñas, M. & Krueger, J. G. Immunology of psoriasis. _Annual review of
immunology_ 32, 227–255 (2014). Article CAS PubMed PubMed Central Google Scholar * Poupon, E. & Nay, B. _Biomimetic organic synthesis_. (Wiley-VCH, 2011). * Meng, F. _et al_.
MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. _Gastroenterology_ 133, 647–58 (2007). Article CAS PubMed Google Scholar * Xu, L.-F.
_et al_. MicroRNA-21 (miR-21) regulates cellular proliferation, invasion, migration, and apoptosis by targeting PTEN, RECK and Bcl-2 in lung squamous carcinoma, Gejiu City, China. _PLoS One_
9, e103698 (2014). Article ADS PubMed PubMed Central CAS Google Scholar * Umemura, S. _et al_. Therapeutic priority of the PI3K/AKT/mTOR pathway in small cell lung cancers as revealed
by a comprehensive genomic analysis. _J. Thorac. Oncol._ 9, 1324–31 (2014). Article CAS PubMed PubMed Central Google Scholar * Carracedo, A. & Pandolfi, P. P. The PTEN-PI3K
pathway: Of feedbacks and cross-talks. _Oncogene_ 27, 5527–5541 (2008). Article CAS PubMed Google Scholar * Rahmani, A., Alzohairy, M., Babiker, A. Y., Rizvi, M. A. & Elkarimahmad,
H. G. Clinicopathological significance of PTEN and bcl2 expressions in oral squamous cell carcinoma. _Int. J. Clin. Exp. Pathol._ 5, 965–971 (2012). CAS PubMed PubMed Central Google
Scholar * Abarca, B. _et al_. Efficient synthesis of an indoloquinolizinium alkaloid selective DNA-binder by ring-closing metathesis. _Org. Lett._ 16, 3464–3467 (2014). Article CAS PubMed
Google Scholar * Gonçalves, C. _et al_. An optimized extended DNA kappa B site that enhances plasmid DNA nuclear import and gene expression. _J. Gene Med._ 11, 401–411 (2009). Article
PubMed CAS Google Scholar Download references ACKNOWLEDGEMENTS This project is funded by Région Centre-Val de Loire (Cosmetosciences project, a global training and research program) and
by “Fonds Pacifique” support. FA is the recipient of Cosmetosciences Ph. D grant. We are thankful to Nicolas Martin and J. F. Butaud and French Polynesia DIREN department for sample
collection, plant material identification and helpful discussions. We would like to thank Prof. Joanna Cichy and Ms. Agnieszka Morytko (Jagiellonian University, 31-007 Kraków, Poland) for
seahorse assay and helpful discussion. AUTHOR INFORMATION AUTHORS AND AFFILIATIONS * Centre de Biophysique Moléculaire, CNRS-UPR4301, 45071, Orléans, France Florence Abdallah & Chantal
Pichon * Université de Paris-Saclay UVSQ, 55 Avenue de Paris, 78000, Versailles, France Gaël Lecellier * Université de la Polynésie Française, UMR 241 EIO, 6570 - 98702, Faa’a, Tahiti,
Polynésie Française Phila Raharivelomanana * Université d’Orléans, Collegium Sciences et Techniques, 45100, Orléans, France Chantal Pichon Authors * Florence Abdallah View author
publications You can also search for this author inPubMed Google Scholar * Gaël Lecellier View author publications You can also search for this author inPubMed Google Scholar * Phila
Raharivelomanana View author publications You can also search for this author inPubMed Google Scholar * Chantal Pichon View author publications You can also search for this author inPubMed
Google Scholar CONTRIBUTIONS Funding acquisition and supervision: C.P. Conceptualization: F.A., P.R., G.L. and C.P. Experimental design: F.A. and C.P. Experimental performance: F.A. All the
authors reviewed the results and approved the final version. CORRESPONDING AUTHOR Correspondence to Chantal Pichon. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing
interests. ADDITIONAL INFORMATION PUBLISHER’S NOTE: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. SUPPLEMENTARY
INFORMATION DATASET 1 RIGHTS AND PERMISSIONS OPEN ACCESS This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation,
distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and
indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to
the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will
need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE
CITE THIS ARTICLE Abdallah, F., Lecellier, G., Raharivelomanana, P. _et al._ _R_. _nukuhivensis_ acts by reinforcing skin barrier function, boosting skin immunity and by inhibiting IL-22
induced keratinocyte hyperproliferation. _Sci Rep_ 9, 4132 (2019). https://doi.org/10.1038/s41598-019-39831-w Download citation * Received: 05 September 2018 * Accepted: 31 January 2019 *
Published: 11 March 2019 * DOI: https://doi.org/10.1038/s41598-019-39831-w SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link
Sorry, a shareable link is not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative