ABSTRACT The prevalence of non-small cell lung cancer (NSCLC) accounts for 85% of all lung cancers, with the Wnt/β-catenin signaling pathway exhibiting robust activation in this particular

subtype. The expression of FAM83A (family with sequence similarity 83, member A) has been found to be significantly upregulated in lung cancer, leading to the stabilization of β-catenin and

activation of the Wnt signaling pathway. In this study, we conducted a screening of down-regulated miRNAs in lung cancer with FAM83A as the target. Ultimately, we identified miR-1 as a

negative regulator of FAM83A and confirmed that FAM83A is a direct target gene of miR-1 through dual luciferase reporter assays. The overexpression of miR-1 significantly attenuated the

degradation complex, and inhibited the proliferation, migration and invasion of NSCLC cells. In summary, miR-1 may be a potential candidate miRNA for the treatment of NSCLC. SIMILAR CONTENT

BEING VIEWED BY OTHERS MIR-1976/NCAPH/P65 AXIS INHIBITS THE MALIGNANT PHENOTYPES OF LUNG ADENOCARCINOMA Article Open access 16 May 2024 MIR-494-3P ENHANCES AGGRESSIVE PHENOTYPE OF NON-SMALL

CELL LUNG CANCER CELLS BY REGULATING SET/I2PP2A Article Open access 02 May 2025 MICRORNA-130B FUNCTIONS AS AN ONCOGENE AND IS A PREDICTIVE MARKER OF POOR PROGNOSIS IN LUNG ADENOCARCINOMA

Article 30 September 2020 INTRODUCTION The Wnt/β-catenin signaling pathway is known to undergo activating mutations in various cancers. However, β-catenin and APC mutations are uncommon in

non-small cell lung cancer (NSCLC). Despite this, the Wnt/β-catenin signaling pathway still plays a crucial role in maintaining the proliferation of NSCLC cell lines, and inhibition of this

pathway can significantly slow down the NSCLC process1. As a result of the suppression of the degradation complex in the activated Wnt signaling pathway, β-catenin that has been stabilized

is transported into the nucleus and triggers the transcription of target genes downstream through its interaction with T cell factor (TCF)/lymphoid enhancer binding factor (LEF), which are

transcription factors2. FAM83A, also known as BJ-TSA-9, exhibits significant upregulation in cases of lung carcinoma3. In our previous work, we found that FAM83A, through its the DUF1669

domain directly interacts with Arm repeats domain of β-catenin and promotes β-catenin nuclear transports to initiate transcription of target genes downstream of Wnt. Repression of FAM83A led

to notable suppression of cellular growth, indicating that targeting FAM83A could be a promising strategy for cancer treatment4. RNA-based therapies show promise in treating diseases that

are currently considered incurable with conventional therapies5. RNA-based therapeutics have been utilized in clinical treatments with the development of RNA delivery technology6. Among

them, microRNAs (miRNAs) represent a pivotal class of gene regulators. These small RNA sequences have a pivotal function in regulating the expression of target genes7,8. The dysregulation of

miRNAs is a key characteristic that distinguishes cancer cells from normal cells. This is particularly evident in the decreased expression of miRNAs that have oncogenic effects and the

increased expression of miRNAs that have anti-oncogene effects. Additionally, miRNA expression profiles vary across different types of cancer9. miRNAs most typically regulate mRNA stability

directly at the RNA level by recognizing sites in the 3ʹ untranslated region (UTR)10. miRNAs have a significant impact on gene expression, and any perturbation of miRNA expression may affect

the stability of target genes and thus cellular homeostasis. Therefore, miRNA screening and application have become crucial areas of basic and translational biomedical research11. This

study focuses on the potential of miRNA gene therapy for lung cancer treatment. In particular, the miRNA screening focused on FAM83A, and it was observed that miR-1 effectively suppressed

the Wnt/β-catenin signaling pathway by targeting FAM83A. Consequently, this inhibition resulted in a notable reduction in the proliferation of lung cancer cells. The miR-1 exhibits high

conservation across mammalian cells and demonstrates low expression levels within various tumor cell types, suggesting its potential role as a tumor suppressor12. Therefore, miR-1 is a

promising and effective miRNA for lung cancer therapy. RESULT IDENTIFICATION OF MIR-1 AS A NEGATIVE REGULATOR OF FAM83A IN HUMAN LUNG CANCER To identify miRNAs that were downregulated in

lung cancer, we analyzed miRNA arrays of lung adenocarcinoma, squamous cell lung cancer, and pan lung cancer in the TCGA database (Data download from https://portal.gdc.cancer.gov/), and

finally screened 16 miRNAs that were significantly downregulated in all types of lung cancer (Figs. 1A,B, S1A,B). In addition, the TCGA lung cancer database revealed a significantly elevated

expression of FAM83A in tumor tissues compared to adjacent tissues (Analyzed by using GEPIA website: http://gepia.cancer-pku.cn/) (Fig. 1C). Considering the significance of FAM83A in lung

cancer, we predicted the potential miRNAs targeting FAM83A in the miR-Walk (http://mirwalk.umm.uni-heidelberg.de/), miRanda (http://www.microrna.org/), and Targetscan

(https://www.targetscan.org/) databases, respectively, and screened 331 miRNAs potentially targeting FAM83A mRNA. After merging the aforementioned collections, five miRNAs were finally

screened through the database that were down-regulated in lung cancer and targeted FAM83A. These miRNAs are miRNA-143, miRNA-486, miRNA-140, miRNA-1, and miRNA-490 (Fig. 1D). Survival

analysis was performed for FAM83A and the five miRNAs (Figs. 1E,F, S2A–D). The results indicated that the downregulation of all miRNAs, except miRNA-143, significantly worsened the prognosis

of lung cancer patients. FAM83A IS A TARGET OF MIR-1 We synthesized and transfected above potential miRNAs targeting FAM83A in 293 T cells. The findings indicated that the upregulation of

miR-1 resulted in a notable decrease in the levels of FAM83A, indicating its promising role as a proficient miRNA for modulating the expression of FAM83A (Fig. 2A,B). We made a prediction on

the seed sequence located in the 3'UTR and introduced mutations to confirm the direct targeting site of FAM83A mRNA by miR-1. Additionally, we employed a dual luciferase reporter gene

system to assess the binding capacity of miR-1 towards the specific region (212-219) within FAM83A 3ʹUTR (Fig. 2C). In the dual-luciferase assay, the relative luciferase activity is used to

measure the regulatory effect of miR-1 on the FAM83A 3ʹUTR. A decrease in relative luciferase activity indicates that miR-1 is binding to the target site on the FAM83A 3ʹUTR, leading to

repression of gene expression. The findings indicated that the seed sequence of the FAM83A 3'UTR can be directly targeted by miR-1, while the mutated FAM83A 3ʹUTR cannot be targeted by

miR-1 (Fig. 2D). Moreover, a noteworthy inverse association was observed between the levels of miR-1 and FAM83A mRNA in the TCGA database, which was further validated through RT-qPCR

analysis (Fig. 2E, F). These findings indicate that FAM83A is subject to direct negative regulation by miR-1. MIR-1 DECREASES WNT/Β-CATENIN SIGNAL THROUGH FAM83A In a previous study, it was

found that FAM83A promotes the stability of β-catenin and initiates the activation of the Wnt/β-catenin signaling pathway. So, we hypothesized that miR-1 expression inhibits the Wnt

signaling pathway through FAM83A. In A549 and H1299 cell lines, we observed a significant reduction in the protein levels of Wnt downstream target genes C-MYC, CyclinD1, and AXIN2 upon

overexpression of miR-1. However, when FAM83A was reintroduced, it effectively reversed the suppression of Wnt target genes caused by miR-1 overexpression (Fig. 3A). Next, we employed the

TCF/LEF transcription factor system labeled with EGFP and mCherry to evaluate the activity of Wnt pathway promoters (Fig. 3B). The data showed that the number of green puncta was

significantly reduced when miR-1 was overexpressed (Fig. 3C,D). However, the decrease could potentially be counteracted by re-expressing the FAM83A. Comparable results were observed when

measuring mRNA levels of C-MYC, CyclinD1, and AXIN2 using RT-qPCR (Fig. 3E–J). These results indicate that miR-1 may have a negative regulation on the Wnt/β-catenin signaling pathway by

targeting FAM83A. In addition, the TCF/LEF promoter is bound by nuclear β-catenin, which triggers the activation of downstream target genes in the Wnt/β-catenin pathway. Consequently, the

importation of β-catenin into the nucleus serves as a significant indicator for Wnt/β-catenin pathway activation. In this study, we evaluated the levels of β-catenin protein in both

cytoplasmic and nuclear compartments. Interestingly, our results demonstrated that miR-1 overexpression led to a increase in cytoplasmic β-catenin levels and an increase reduction in its

nuclear localization. Conversely, reintroduction of FAM83A resulted in a reversal of these effects (Fig. 3K–M). Overall, the findings of this part highlight the significance of miR-1 in

reducing the nuclear translocation of β-catenin when inhibiting the Wnt/β-catenin signaling pathway through FAM83A. MIR-1 PROMOTES THE ASSEMBLY OF Β-CATENIN DEGRADATION COMPLEX THOUGH FAM83A

The degradation complex of β-catenin plays a crucial role in regulating the stability of β-catenin, which is essential for activating the Wnt/β-catenin signaling pathway. In order to

investigate how miR-1 affects the stability of the destruction complex through the FAM83A pathway, our study focused on examining whether miR-1 influences this process. Our results showed

that overexpression of miR-1 led to a decrease in β-catenin protein levels, but when FAM83A was reintroduced, it restored the protein levels of β-catenin (Fig. 4A). Furthermore,

overexpression of miR-1 accelerated the β-catenin degradation (Fig. 4B). The co-immunoprecipitation (co-IP) technique was employed to evaluate the interaction between GSK3β and β-catenin,

which reflects the activity of the degradation complex responsible for β-catenin. The findings revealed that miR-1 overexpression augmented the binding capacity between GSK3β and β-catenin,

thereby facilitating the formation of the degradation complex. This effect could be counteracted by reintroducing FAM83A (Fig. 4C,D). The cells were subjected to MG132 treatment, which is a

substance that inhibits proteasomes, in order to evaluate the degree of β-catenin ubiquitination after miR-1 was overexpressed. It was observed that the overexpression of miR-1 led to an

increase in β-catenin ubiquitination levels, while the reintroduction of FAM83A reduced β-catenin ubiquitination and stabilized the protein level of β-catenin (Fig. 4E). The data presented

above indicates that miR-1 has the potential to promote the formation of the β-catenin degradation complex through its interaction with FAM83A, leading to an expedited breakdown of β-catenin

and ultimately resulting in the inhibition of the Wnt/β-catenin signaling pathway. MIR-1 INHIBITS HUMAN LUNG CANCER PROLIFERATION, MIGRATION AND INVASION THROUGH FAM83A To delve deeper into

the involvement of miR-1 in NSCLC, we established a stable expression system for miR-1 in A549 and H1299 cell lines (Fig. S3A,B). Reversal of the observed phenomenon was achieved through

the re-expression of FAM83A, which resulted in a slower migration rate for the miR-1 overexpression group compared to the negative control group in the wound healing experiment (Fig. 5A–D).

MTT also exhibited a decline in the measured optical density (OD) value, indicating a reduction in cellular proliferation capacity (Fig. 5E,F). The Edu incorporation assay revealed a notable

decrease in DNA synthesis capacity in H1299 and A549 cells upon miR-1 overexpression, as opposed to the control group. Intriguingly, reintroducing FAM83A reinstated the proliferative

potential of both H1299 and A549 cells (Fig. 5G–J). The results of the colony formation assay indicated that the inhibitory effect of miR-1 on clone numbers could be counteracted by

restoring FAM83A expression (Fig. 5K–M). Meanwhile, the overexpression of miR-1 was found to suppress the migratory and invasive abilities of H1299 and A549 cells, as demonstrated by

transwell assays (Fig. 5N–S). These findings collectively indicate that FAM83A is targeted by miR-1 to inhibit proliferation, migration, and invasion in H1299 and A549 cells. DISCUSSION The

NSCLC exhibits a substantial increase in the activation of the canonical Wnt signaling pathway, which plays a crucial role in facilitating cellular proliferation, migration, and invasion1.

The upregulation of FAM83A expression is notably observed in lung cancer. However, despite limited understanding, substantial evidence exists to support the involvement of FAM83A in the

promotion of lung cancer by activating the Wnt/β-catenin signaling pathway and subsequently augmenting cellular proliferation13. In our previous study, we presented evidence of the interplay

between FAM83A and β-catenin facilitated by the DUF1669 domain, underscoring its pivotal function in impeding the formation of the β-catenin degradation complex, Facilitating the nuclear

translocation of β-catenin and upholding β-catenin stability4. Additionally, FAM83A has been shown to design inhibitory peptides with significant implications for cancer therapy4. The

results suggest that FAM83A represents a promising target for effective cancer therapy. Effective targeting of FAM83A has been observed with miR-1, which exhibits significant down-regulation

in patients diagnosed with lung cancer. In H1299 and A549 cells line, we confirmed that miR-1 attenuated the expression of Wnt downstream target genes by suppressing FAM83A. GSK3β

phosphorylates β-catenin at the amino terminus serine/threonine residues, leading to its binding with β-Trcp protein that undergoes covalent ubiquitination and subsequent proteasomal

degradation1. Therefore, the interaction between GSK3β and β-catenin plays a vital role in the degradation process of β-catenin through ubiquitination. In this study, we present evidence

that miR-1 suppresses FAM83A expression to enhance the functionality of the β-catenin degradation complex, leading to reduced proliferation, migration, and invasion capabilities in NSCLC

cells. Consequently, this promotes the translocation of β-catenin into the nucleus (Fig. 6). The RNA-based therapeutic approach precisely targets and modulates the activity of endogenous

miRNAs to regulate gene expression. Given the pivotal role of miRNAs in both normal physiological processes and pathological conditions, miRNA therapy aims to restore miRNA expression

homeostasis by specifically targeting and manipulating specific miRNAs14. RNA-based therapy represents a promising therapeutic modality for currently incurable diseases, particularly in the

realm of cancer treatment5. With the advancement of miRNA nano-delivery technology, RNA-based molecular therapy has been implemented in clinical cancer treatment15. Hence, it is crucial to

thoroughly examine miRNAs with outstanding precision and maximum effectiveness as potential therapeutic agents for diverse ailments. In this investigation, we performed an extensive

assessment of miR-1 interaction with FAM83A by employing both database analysis and experimental verification. The dysregulation of miR-1 in lung cancer is intricately associated with the

initiation and progression of this malignancy. Notably, the downregulation of miR-1 emerges as a pivotal factor facilitating the advancement of lung cancer. Previous studies have

demonstrated that downregulation of miR-1 promotes the upregulation of AXIN2, CyclinD1, and other related proteins in lung cancer cells, thereby facilitating the proliferation of these

cells16. This discovery suggests a possible link between the decrease in miR-1 and the initiation of the Wnt/β-catenin signaling pathway. Therefore, manipulating the expression level of

miR-1 could offer a potential targeted therapeutic strategy for addressing lung cancer17. While the inhibitory effects of the miRNA-1-FAM83A axis on lung cancer growth and metastasis have

been established in previous studies, there is still a need to further elucidate its underlying mechanism comprehensively18. Here, we have further investigated the regulatory mechanism of

the miRNA-1-FAM83A axis in promoting lung cancer cell growth and demonstrated the potential anti-lung cancer properties of miRNA-1 through its ability to target FAM83A. Our findings suggest

that miRNA-1 enhances the activity of a complex responsible for degrading β-catenin, leading to inhibition of the Wnt/β-catenin signaling pathway. In the past few years, there has been a

significant amount of research conducted on miR-1 and its impact on different physiological processes and diseases. These studies have shown that miR-1 is often down-regulated in various

types of cancer, suggesting its potential role in the development of tumors19. Animal studies have demonstrated a significant down-regulation of miR-1 in the mouse model of ethyl carbamate

induced lung cancer20. Recently, there has been an observation of decreased levels of miR-1 in tumor tissues and serum samples obtained from patients diagnosed with small cell lung cancer.

This finding highlights the importance of miR-1 as a significant biomarker for the progression and spread of tumors. The introduction of miR-1 into cell lines associated with small cell lung

cancer led to a notable decrease in both the growth and metastasis of tumor cells. In terms of mechanism, it was discovered that miR-1 directly targets CXCR4, thereby impeding ability of

FOXM1 to bind to the RRM2 promoter. Consequently, this inhibition effectively suppresses the growth and metastasis of lung cancer cells21. The regulatory role of miR-1 in tumor cells

encompasses multiple facets, including targeting resistance mechanisms, apoptosis pathways, and immune-related genes to effectively impede tumor cell proliferation22,23,24. The progression

of tumors arises from intricate and multifaceted interactions between malignant cells and their microenvironment25. Exosomes are extracellular vesicles consisting of phospholipid bilayers

that are ubiquitous in various body fluids, carrying miRNA information from parental cells and communicating with recipient cells through binding to their corresponding ligands26. Exosomal

miRNAs have been demonstrated to exert an influence on the tumor microenvironment through modulation of the extracellular matrix and immune system, thus extensively investigated as potential

tumor biomarkers27,28. For instance, the presence of exosomal has-miR-1-3p in cerebrospinal fluid can serve as a valuable biomarker for assessing non-small cell lung cancer metastasis, and

the expression level of miR-1 gradually escalates over the course of treatment29. This observation may be attributed to the ability of miR-1 to modulate the epithelial-mesenchymal transition

(EMT) process in cancer cell30. Cumulatively, these lines of evidence indicate that miR-1 plays a pivotal role in facilitating tumor cell proliferation, migration, and invasion. Reversing

the abnormal activation of the Wnt/β-catenin signaling pathway is crucial in combating a wide range of human cancers, making it an essential focus for pharmacological intervention. FAM83A

plays a vital role in modulating the Wnt/β-catenin signaling pathway. In brief, our results shed light on how miR-1 hinders the advancement of lung cancer by directly targeting the

FAM83A/Wnt/β-catenin pathway. Importantly, our results provide a rationale for RNA-based therapeutic strategies aimed at targeting miR-1 to combat lung cancer development. EXPERIMENTAL

PROCEDURES CELL LINES, REAGENTS, AND ANTIBODIES Human non-small cell lung cancer cell line A549, H1299 and HEK293T were purchased from the National Collection of Authenticated Cell Cultures,

Chinese Academy of Science (SCSP-538, SCSP-589 and GNHu44) and stored in our lab. HEK293T, A549 and H1299 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (G4515,

Servicebio, China). All culture mediums were supplemented with 10% fetal bovine serum (G10270-106, Gibco, USA), 100 U/ml penicillin G and 100 μg/ml streptomycin (P1400, Solarbio) at 37 °C in

a humidified incubator containing 5% CO2. The medium was replaced every 2–3 days and the cell was subcultured and used for an experiment at 80–90% confluence. Commercially available

antibodies and dilutions used are as follows:anti-FAM83A (Proteintech, 20,618-1-AP; 1:1000 dilution), anti-GAPDH (Proteintech, 60,004-1-Ig; 1:5000 dilution),anti-C-MYC (Proteintech,

10,828-1-AP; 1:1000 dilution),anti-CyclinD1 (Proteintech, 60,186-1-Ig; 1:5000 dilution),anti-AXIN2 (Proteintech, 20,540–1-AP; 1:1000 dilution),anti-β-catenin(Proteintech, 51,067-2-AP; 1:1000

dilution),anti-Histone H3(Proteintech, 17,168–1-AP; 1:1000 dilution),Anti-GSK3β (Cell Signaling Technology, 9315S; 1:1000 dilution),Anti-Ubi (MBL, MK-12-3; 1:1000 dilution). 7TGC was kind

given from RoelNusse (Addgene, 24304). miRNA-143-5p minics, miRNA-486-3p minics, miRNA-486-5p minics, miRNA-140-3p minics, miRNA-1 minics, miRNA-490-3p and miR control were designed and

synthesized by GenePharma (Shanghai, China). LENTIVIRAL PRODUCTION AND CREATION OF STABLE CELL LINES Pre-miR-1 or scramble RNA were subcloned into the lentiviral vector

pCDH-CMV-MCS-EF1-turboRFP-T2A-puro. DNA fragments encoding FAM83A were subcloned into lentiviruses vector pLVX-IRES-Neo. 5 μg lentiviral constructs were co-transfected with viral packaging

plasmids 3 μg psPAX2 and 3 μg pMD2.G into 293 T cells in 10 cm dishes for the lentiviral particle production. The viral supernatant was harvested at 48 h and 72 h post-transfection and

filtered through a 0.22 µm membrane. After applying the viral supernatant to A549 and H1299 cells with 10 μg/μl of polybrene (Solarbio, H8761), selection for puromycin and/or G418 resistance

was initiated 48 h after transfection. The selection media was changed every 3–4 days for several weeks, and clones of puromycin and/or G418—resistant cells were isolated and expanded for

further characterization. The stable cells were maintained with complete culture medium with 2 μg/mL puromycin (Beyotime, ST551) and/or 100 μg/mL G418 (Yeasen, 60220ES03). DUAL-LUCIFERASE

REPORTER ASSAY To assess the regulatory effects of miR-1 on FAM83A mRNA, dual-luciferase reporter assay was performed. the 3′UTR of FAM83A containing 212–219 bp and mutant were synthesized

by Sangon Biotech and cloned between the SacI and XbaI sites of the pmiRGLO dual-luciferase miRNA target expression vector (Promega, E1330). The primer sequences specific to FAM83A 3′UTR

used for the dual-luciferase reporter assay were (forward) 5′-CTTTGACCTGTGCAGCACATTCCAGAAGGTTCCAGGGAGGTTGT-3′ and (reverse) 5′-CTAGACAACCTCCCTGGAACCTTCTGGAATGTGCTGCACAGGTCAAAGAGCT-3′. The

FAM83A 3′UTR mutant primer sequences were (forward) 5′-CTTTGACCTGTGCAGCTGTAAGGTGAAGGTTCCAGGGAGGTTGT-3′ and (reverse) 5′-CTAGACAACCTCCCTGGAACCTTCACCTTACAGCTGCACAGGTCAAAGAGCT-3′. RNA

EXTRACTION AND REAL-TIME PCR Total RNA was isolated from cells using TRIzol reagent (Invirogen) according to the manufacturer’s protocol. RNAs were quantified using a NanoDrop One instrument

(ThermoFisher). cDNA was reverse transcribed using a miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) (Vazyme, MR101-01). Primers for miR-1 reverse transcription:

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATACAT. For gene expression analysis, real-time PCR was performed using a QuantStudio 3 instrument (Thermo, USA) and miRNA Universal SYBR qPCR

Master Mix (Vazyme, MQ101-02). Expression of microRNAs was normalized to that U6 shRNA. The sequences of the primers used in real-time PCR were shown in Table 1. WOUND-HEALING ASSAY A549 and

H1299 cells transfected with or without miR-1 overexpression and re-expression FAM83A or vector were cultured after the formation until 80% confluence, then the surface of monolayers was

scratched with pipette tips. PBS was used to move cell debris and the conditioned medium was added. After healing for 24 h, the scratches at the same wound location were observed and

pictured under an Olympus FSX100 microscope. TRANSWELL ASSAY For migration, A549 and H1299 cells transfected with or without miR-1 overexpression and re-expression FAM83A or vector were

seeded in upper transwell chamber (Corning Incorporated, #3422) with 1 × 105 cells in 100uL of FBS-free medium. For invasion, transwell chamber pre-covered with Matrigel (Corning

Incorporated, 356234) was used. Meanwhile, 500μL of medium containing 20% FBS was added to the lower cavity. 24 h later, the cells were fixed by 0.1% crystal violet and stained by 4% PFA Fix

Solution. Under microscope, the number of invasive cells from 3 fields was counted. MTT ASSAY A549 and H1299 cells (1 × 103 cells/well) transfected with or without miR-1 overexpression and

re-expression FAM83A or vector were seeded into 96-well plates, then cells were stained at the indicated time points with 100 μL sterile MTT dye (0.5 mg/ml; Sigma, M2128) for 4 h at 37 °C.

After adding 150 μL DMSO (Biosharp, BS186), the number of viable cells was assessed by measurement of the absorbance at 450 nm by a microplate reader. All experiments were performed in

triplicate. COLONY FORMATION ASSAY A549 and H1299 cells transfected with or without miR-1 overexpression and re-expression FAM83A or vector were seeded into a 12-well plate and incubated

with complete medium at 37 °C for 2–3 weeks. Then, the cells were fixed with 4% paraformaldehyde and stained with 2% crystal violet. Images were obtained and the number of colonies was

counted. IMMUNOPRECIPITATION ASSAY Cells were washed twice with phosphate-buffered saline (PBS; Servicebio, WGSH30256-01) and lysed with RIPA lysis buffer (50 mM Tris–HCl pH 7.4, 150 mM

NaCl, 1% Triton X-100 [Sangon Biotech, 9002-93-1], 10 mM NaF, and 1 mM EDTA) containing proteinase inhibitor cocktail (Biomake, B14001). Protein concentration was measured using a BioRad

Protein Assay kit (BioRad, 5,000,006). Cell lysates were incubated overnight with pri-mary antibodies according to each individual experiment after pretreatment with IgG and protein A/G

magic beads (Bimake, B23202), and then incubated with protein A/G magic beads for 2 h at 4 °C. The beads were spun down and washed five or six times, and the Enhanced BCA Protein Assay Kit

(Beyotime, P0009) was used to detect the concentration of proteins. For the ubiquitination assay, before collection with the denaturation buffer (10 mM imidazole, 0.1 M Na2HPO4/NaH2PO4 and 6

 M guanidine- HCl), cells were treated with 10 μM MG132 for 6 h. The lysates were mixed with the indicated antibodies at 4 °C overnight, followed by washes and western blotting assay.

IMMUNOFLUORESCENCE AND CONFOCAL MICROSCOPY A549 cells transfected with the appropriate plasmids were grown on 12-well plates, and for confocal microscopy on glass chambers, at 60% density

and cultured for 48 h. Cells were fixed with 4% paraformaldehyde in PBS and permeabilized with 0.5% Triton X-100. Then cells were blocked with 10% goat serum (Boster, AR0009) and

subsequently incubated with primary antibodies and fluorescence-labeled secondary antibodies. DAPI (Solarbio, C0065) was used for nuclei staining. For confocal microscopy, cells plated on

the glass chambers were examined with a confocal laser-scanning microscope (Leica SP8, Wetzlar, Germany) using a 63 × oil immersion objective. Data analysis was performed using the Leica LAS

AF Lite software. 5-ETHYNYL-20-DEOXYURIDINE (EDU) INCORPORATION ASSAY EdU labeled A549 and H1299 transfected with or without miR-1 overexpression and re-expression FAM83A or vector were

examined with the BeyoClick™ EdU Cell Proliferation Kit with Alexa Fluor 555 (Beyotime, C0075S). Cells were photographed under an Olympus FSX100 microscope. WESTERN BLOT ANALYSIS Cell

lysates or immunoprecipitates were heated in 1 × SDS loading buffer (100 mM Tris–HCl [pH 6.8], 4% [wt:vol] SDS, 200 mM dithiothreitol, 0.2% [wt:vol] bromophenol blue, and 20% [vol:vol]

glycerol) for 15 min at 98 °C. Proteins were separated by SDS-PAGE gels and transferred to 0.45 μm polyvinylidene fluoride (PVDF) membranes (Millipore, IPFL85R). After the PVDF membranes had

been blocked with TBS-T containing 5% skimmed milk at room temperature for 2 h and incubated with primary antibodies and secondary antibodies, the protein signals in the PVDF membranes were

detected using SuperPico ECL Chemiluminescence Kit (Vazyme, E422-02) according to the manufacturer’s instructions. STATISTICAL ANALYSIS All experiments were performed independently at least

three times. All statistical analysis was performed using GraphPad Prism 8.0 software (GraphPad, La Jolla, CA, USA). All data are presented as mean ± SD (standard deviation) from

triplicates. _p_ values < 0.05 were statistically significant. Statistical analysis was done using paired Student’s _t_-test; *represents _P_ < 0.05, **represents _P_ < 0.01 and

***represents _P_ < 0.001. DATA AVAILABILITY The data that support the findings of this study are available from the corresponding author upon reasonable request. REFERENCES * Stewart, D.

J. Wnt signaling pathway in non-small cell lung cancer. _J. Natl. Cancer. Inst._ 106, djt356 (2014). Article  PubMed  Google Scholar  * Nusse, R. & Clevers, H. Wnt/beta-catenin

signaling, disease, and emerging therapeutic modalities. _Cell._ 169, 985–999 (2017). Article  CAS  PubMed  Google Scholar  * Li, Y. _et al._ BJ-TSA-9, a novel human tumor-specific gene, has

potential as a biomarker of lung cancer. _Neoplasia._ 7, 1073–1080 (2005). Article  CAS  PubMed  PubMed Central  Google Scholar  * Zhou, C. _et al._ B-lymphoid tyrosine kinase-mediated

FAM83a phosphorylation elevates pancreatic tumorigenesis through interacting with beta-catenin. _Signal Transduct. Target. Ther._ 8, 66 (2023). Article  CAS  PubMed  PubMed Central  Google

Scholar  * Kim, D. H. & Rossi, J. J. Strategies for silencing human disease using RNA interference. _Nat. Rev. Genet._ 8, 173–184 (2007). Article  CAS  PubMed  Google Scholar  * Sahin,

U., Kariko, K. & Tureci, O. MRNA-based therapeutics-developing a new class of drugs. _Nat. Rev. Drug Discov._ 13, 759–780 (2014). Article  CAS  PubMed  Google Scholar  * Ambros, V. The

functions of animal MicroRNAs. _Nature._ 431, 350–355 (2004). Article  ADS  CAS  PubMed  Google Scholar  * Shukla, G. C., Singh, J. & Barik, S. MicroRNAs: Processing, maturation, target

recognition and regulatory functions. _Mol. Cell Pharmacol._ 3, 83–92 (2011). CAS  PubMed  PubMed Central  Google Scholar  * Lee, Y. S. & Dutta, A. MicroRNAs in cancer. _Annu. Rev.

Pathol._ 4, 199–227 (2009). Article  CAS  PubMed  PubMed Central  Google Scholar  * Lee, R. C., Feinbaum, R. L. & Ambros, V. The _C_. _elegans_ heterochronic gene lin-4 encodes small

RNAs with antisense complementarity to lin-14. _Cell._ 75, 843–854 (1993). Article  CAS  PubMed  Google Scholar  * Hill, M. & Tran, N. MiRNA interplay: Mechanisms and consequences in

cancer. _Dis. Model. Mech._ 14, dmm047662 (2021). Article  CAS  PubMed  PubMed Central  Google Scholar  * Khan, P. _et al._ MicroRNA-1: Diverse role of a small player in multiple cancers.

_Semin. Cell Dev. Biol._ 124, 114–126 (2022). Article  CAS  PubMed  Google Scholar  * Zheng, Y. W. _et al._ FAM83a promotes lung cancer progression by regulating the Wnt and Hippo signaling

pathways and indicates poor prognosis. _Front. Oncol._ 10, 180 (2020). Article  PubMed  PubMed Central  Google Scholar  * Seyhan, A. A. Trials and tribulations of MicroRNA therapeutics.

_Int. J. Mol. Sci._ 25, 1469 (2024). Article  CAS  PubMed  PubMed Central  Google Scholar  * Ganju, A. _et al._ MiRNA nanotherapeutics for cancer. _Drug Discov. Today._ 22, 424–432 (2017).

Article  CAS  PubMed  Google Scholar  * Dai, S., Li, F., Xu, S., Hu, J. & Gao, L. The important role of MiR-1-3P in cancers. _J. Transl. Med._ 21, 769 (2023). Article  CAS  PubMed 

PubMed Central  Google Scholar  * Wang, Y., Luo, X., Liu, Y., Han, G. & Sun, D. Long noncoding RNA RMRP promotes proliferation and invasion via targeting MiR-1-3P in non-small-cell lung

cancer. _J. Cell. Biochem._ 120, 15170–15181 (2019). Article  CAS  PubMed  Google Scholar  * Liu, P. J. _et al._ Involvement of MicroRNA-1-FAM83a axis dysfunction in the growth and motility

of lung cancer cells. _Int. J. Mol. Sci._ 21, 8833 (2020). Article  CAS  PubMed  PubMed Central  Google Scholar  * Safa, A. _et al._ MiR-1: A comprehensive review of its role in normal

development and diverse disorders. _Biomed. Pharmacother._ 132, 110903 (2020). Article  CAS  PubMed  Google Scholar  * Melkamu, T., Zhang, X., Tan, J., Zeng, Y. & Kassie, F. Alteration

of MicroRNA expression in vinyl carbamate-induced mouse lung tumors and modulation by the chemopreventive agent indole-3-carbinol. _Carcinogenesis._ 31, 252–258 (2010). Article  CAS  PubMed

  Google Scholar  * Khan, P. _et al._ MicroRNA-1 attenuates the growth and metastasis of small cell lung cancer through CXCR4/FOXM1/RRM2 axis. _Mol. Cancer._ 22, 1 (2023). Article  CAS 

PubMed  PubMed Central  Google Scholar  * Wu, Y., Pu, N., Su, W., Yang, X. & Xing, C. Downregulation of MiR-1 in colorectal cancer promotes radioresistance and aggressive phenotypes. _J.

Cancer._ 11, 4832–4840 (2020). Article  CAS  PubMed  PubMed Central  Google Scholar  * Peng, J. _et al._ Upregulation of MicroRNA-1 inhibits proliferation and metastasis of breast cancer.

_Mol. Med. Rep._ 22, 454–464 (2020). Article  CAS  PubMed  PubMed Central  Google Scholar  * Li, D. _et al._ Programmed death ligand-1 (PD-L1) regulated by NRF-2/MicroRNA-1 regulatory axis

enhances drug resistance and promotes tumorigenic properties in sorafenib-resistant hepatoma cells. _Oncol. Res._ 28, 467–481 (2020). Article  PubMed  PubMed Central  Google Scholar  *

Quail, D. F. & Joyce, J. A. Microenvironmental regulation of tumor progression and metastasis. _Nat. Med._ 19, 1423–1437 (2013). Article  CAS  PubMed  PubMed Central  Google Scholar  *

Li, B., Cao, Y., Sun, M. & Feng, H. Expression, regulation, and function of exosome-derived MiRNAs in cancer progression and therapy. _Faseb. J._ 35, e21916 (2021). Article  CAS  PubMed

  Google Scholar  * Sun, Z. _et al._ Effect of exosomal MiRNA on cancer biology and clinical applications. _Mol. Cancer._ 17, 147 (2018). Article  PubMed  PubMed Central  Google Scholar  *

Li, J. _et al._ Exosome detection via surface-enhanced Raman spectroscopy for cancer diagnosis. _Acta Biomater._ 144, 1–14 (2022). Article  CAS  PubMed  Google Scholar  * Li, H. et al.

Cerebrospinal fluid exosomal MicroRNAs as biomarkers for diagnosing or monitoring the progression of non-small cell lung cancer with leptomeningeal metastases. _Biotechnol. Genet. Eng. Rev._

1–22 (2023). * Han, C. _et al._ MicroRNA-1 (MiR-1) inhibits gastric cancer cell proliferation and migration by targeting MET. _Tumour Biol._ 36, 6715–6723 (2015). Article  CAS  PubMed 

Google Scholar  Download references FUNDING This work was supported by the National Natural Science Foundation of China (82273970 and 32070726 to J.F.T., 32270768 to C.F.Z., 82370715 to

X.Z.C.), Innovation Group Project of Hubei Province (2023AFA026 to J.F.T.), The National Key R&D Program of China (2023YFC2507900). AUTHOR INFORMATION AUTHORS AND AFFILIATIONS * Key

Laboratory of Fermentation Engineering (Ministry of Education), National “111” Center for Cellular Regulation and Molecular Pharmaceutics, Cooperative Innovation Center of Industrial

Fermentation (Ministry of Education and Hubei Province), Hubei Key Laboratory of Industrial Microbiology, School of Life and Health Sciences, Hubei University of Technology, Wuhan, 430068,

People’s Republic of China Wenbin Yuan, Wei Liu, Huili Huang, Xingyu Chen, Rui Zhang, Hao Lyu, Shuai Xiao, Dong Guo, Qi Zhang, Cefan Zhou & Jingfeng Tang * Membrane Protein Disease

Research Group, Department of Physiology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB, Canada Xing-Zhen Chen * Department of Biological Sciences, University of

Alberta, Edmonton, AB, Canada Declan William Ali * Department of Biochemistry, University of Alberta, Edmonton, AB, Canada Marek Michalak Authors * Wenbin Yuan View author publications You

can also search for this author inPubMed Google Scholar * Wei Liu View author publications You can also search for this author inPubMed Google Scholar * Huili Huang View author publications

You can also search for this author inPubMed Google Scholar * Xingyu Chen View author publications You can also search for this author inPubMed Google Scholar * Rui Zhang View author

publications You can also search for this author inPubMed Google Scholar * Hao Lyu View author publications You can also search for this author inPubMed Google Scholar * Shuai Xiao View

author publications You can also search for this author inPubMed Google Scholar * Dong Guo View author publications You can also search for this author inPubMed Google Scholar * Qi Zhang

View author publications You can also search for this author inPubMed Google Scholar * Declan William Ali View author publications You can also search for this author inPubMed Google Scholar

* Marek Michalak View author publications You can also search for this author inPubMed Google Scholar * Xing-Zhen Chen View author publications You can also search for this author inPubMed 

Google Scholar * Cefan Zhou View author publications You can also search for this author inPubMed Google Scholar * Jingfeng Tang View author publications You can also search for this author

inPubMed Google Scholar CONTRIBUTIONS W.Y., wrote the manuscript and performed molecular biology experiments. J.T. and C.Z. designed the whole project and supervised all experiments. W.Y.,

W.L., H.H., X.C., R.Z., H.L., S.X., D.G. and Q.Z. conducted all experiments and analyzed the data. D.W. and M.M., X.-Z.C., provided support with experimental and clinical techniques. All

authors read and approved the final manuscript. All authors consent to publication. CORRESPONDING AUTHORS Correspondence to Cefan Zhou or Jingfeng Tang. ETHICS DECLARATIONS COMPETING

INTERESTS The authors declare no competing interests. ADDITIONAL INFORMATION PUBLISHER'S NOTE Springer Nature remains neutral with regard to jurisdictional claims in published maps and

institutional affiliations. SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES. SUPPLEMENTARY INFORMATION 1. SUPPLEMENTARY INFORMATION 2. SUPPLEMENTARY INFORMATION 3. RIGHTS AND PERMISSIONS

OPEN ACCESS This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution

and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you

modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in

this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative

Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a

copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Yuan, W., Liu, W., Huang, H. _et al._ Screening

and identification of miRNAs negatively regulating FAM83A/Wnt/β-catenin signaling pathway in non-small cell lung cancer. _Sci Rep_ 14, 17394 (2024).

https://doi.org/10.1038/s41598-024-67686-3 Download citation * Received: 24 April 2024 * Accepted: 15 July 2024 * Published: 29 July 2024 * DOI: https://doi.org/10.1038/s41598-024-67686-3

SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to

clipboard Provided by the Springer Nature SharedIt content-sharing initiative KEYWORDS * Non-small cell lung cancer * FAM83A * miR-1 * Wnt/β-catenin