ABSTRACT The genetic model plant _Arabidopsis thaliana_ (arabidopsis) has been instrumental to recent advances in our understanding of the molecular function of the plant immune system.

However, this work has not yet included plant associated and phytopathogenic yeasts largely due to a lack of yeast species known to interact with arabidopsis. The plant phylloplane is a

significant habitat for neutral-residents, plant-growth and health-promoting species, and latent-pathogenic species. However, yeast phylloplane residents of arabidopsis remain underexplored.

To address this, resident yeasts from the phyllosphere of wild arabidopsis collected in field conditions have been isolated and characterized. A total of 95 yeast strains representing 23

the arabidopsis phylloplane and have created culture resources and information useful in the development of model systems for arabidopsis-yeast interactions. SIMILAR CONTENT BEING VIEWED BY

OTHERS OBLIGATE BIOTROPH DOWNY MILDEW CONSISTENTLY INDUCES NEAR-IDENTICAL PROTECTIVE MICROBIOMES IN _ARABIDOPSIS THALIANA_ Article 16 November 2023 COMMENSAL LIFESTYLE REGULATED BY A

NEGATIVE FEEDBACK LOOP BETWEEN _ARABIDOPSIS_ ROS AND THE BACTERIAL T2SS Article Open access 11 January 2024 QUANTITATIVE COMPARISON BETWEEN THE RHIZOSPHERE EFFECT OF _ARABIDOPSIS THALIANA_

AND CO-OCCURRING PLANT SPECIES WITH A LONGER LIFE HISTORY Article 08 July 2020 INTRODUCTION Plants constantly interact with a large number of microorganisms, including bacteria, oomycetes,

filamentous fungi, and yeasts. Bacteria are the best studied plant-associated microbes and yeasts have received the least attention. These microbes colonize all plant surfaces, where each

plant compartment or structure has its own distinct microbiome. The rhizosphere and endophytic microbiota are the most thoroughly explored and offer numerous examples of microbes modulating

plant growth, mineral absorption, and immunity1,2,3,4. The phyllosphere is termed as the total surface of aerial parts of plants that is colonized by microorganisms. A variety of bacteria,

yeasts and filamentous fungi have been isolated from the phyllosphere of several plant species5,6,7,8,9,10. Physical barriers and multiple chemical factors limit the growth and survival of

microbes in the phyllosphere. However, the energy content of leaf surface components and simple sugars leached from the interior tissues11,12 make the phyllosphere a considerable microbial

habitat. Microbes residing in the phyllosphere can have various lifestyles and modes of interaction with the host, being neutral residents, latent pathogens, or plant-health and -growth

promoters. Many plant associated microorganisms, including both growth-promoting and pathogenic microbes, have the ability to synthesize the plant developmental hormone auxin, including the

most common auxin, indole-3-acetic acid (IAA) which is responsible for division, elongation and differentiation of plant cells and tissues. Increased attention has been paid to the role of

microbial IAA in plant-microbe interactions. It was suggested that auxin production capability might be an important colonization strategy for the phyllosphere environment13. IAA-producing

bacteria and fungi are able to promote plant growth14,15. Therefore, they are suggested as potential of bio-fertilizers. The genetic model plant, _Arabidopsis thaliana_ (arabidopsis) is a

well characterized model for plant microbe interactions. This encompasses host and non-host pathogen-interaction systems, root-associated microbiome studies, and endophytic fungi. Indeed,

arabidopsis has been instrumental in defining the basis of plant immunity, including mechanisms engaged in the perception microbe associated molecular patterns (MAMPs) in MAMP-triggered

immunity and _Resistance (R_)-gene function in signalling of effector-triggered immunity16,17. These studies have focused on fungi, bacteria and oomycetes, but not yeasts. In mammals, a

distinct set of immune receptors responsible for perception of yeast-specific MAMPs have been found18. Thus, it can be expected that in plants yeasts engage a distinct, and yet unknown, set

of immune receptors. The ability of yeast cell wall components to induce plant immunity has been demonstrated19. Specifically, baker’s yeast cell-wall and glucopeptide components exhibited

elicitor activity in arabidopsis. Knowledge of phyllosphere yeasts and, in general, of plant-yeast interactions is required for a comprehensive view of plant health. However, the power of

arabidopsis as a genetic model organism has not been utilized in the study of plant-yeast interactions due to a lack of yeasts known to interact with arabidopsis. In this study arabidopsis

phyllosphere resident yeasts were isolated, identified, and physiologically characterized to clarify the nature of their interaction with arabidopsis and create resources for genetic studies

of plant-yeast interactions. RESULTS ISOLATION OF YEASTS FROM THE ARABIDOPSIS PHYLLOSPHERE Few naturally occurring yeasts that are associated with, or pathogenic on, arabidopsis are

currently described. To rapidly assess the presence of yeasts, whole rosette imprints of wild arabidopsis collected in the field were cultured using a medium that favours the growth of

yeasts. These cultures (Fig. 1a) indicate a high number and apparent wide variety of microbes were present, the majority of which had a colony morphology consistent with yeasts. This result

prompted further investigation of arabidopsis associated yeasts. Wild arabidopsis were collected from three sites in Helsinki; site name, location and samples collected are listed in Table

1. Two sites (Kulosaari and Mustikkamaa) are on islands of the Baltic coast and separated by circa 300 metres, while the third site (Kivikko) was circa 5 km inland. Multiple samples from the

same site were always collected from plants at least two metres apart. Serial dilutions of leaf wash solutions were plated and grown at room temperature. A typical plate is depicted in Fig.

1b. Dilute (0.2 x) potato dextrose agar (PDA) was selected as a culture medium with the reasoning that a nutrient-poor, plant-based medium lacking high levels of exogenous amino acids would

mimic the conditions in the phyllosphere11,20. Plates were monitored daily over two weeks and colonies marked and picked as they appeared. Typically 3–5 colonies with similar colour and

morphology were picked and streaked on 0.2 x PDA plates to isolate pure single colonies. Isolated colonies were regrown in replicated microtitre plates for storage and DNA isolation. DNA

samples were used to PCR amplify rDNA internal transcribed spacer (ITS) sequences for identification. Isolates producing no ITS PCR product were observed by light microscopy to eliminate

prokaryotes and PCR was retested with new cultures and DNA samples. Samples failing these tests (60.9% of colonies picked) were eliminated from further analysis. ITS PCR products were

subjected to restriction fragment polymorphism analysis to classify the yeasts into operational taxonomic units (OTUs). For isolate identification and definition of OTUs, restriction

patterns and ITS sequencing were used (Supplementary Table S1). For Samples A, B and C collected from Kivikko in May of 2013, there were totally 70 novel yeast strains isolated and

identified out of 155 picked colonies. From a total of 56 colonies picked from the November 2013 samples, only one new OTU from Kulosaari and one from Mustikkamaa were found. The low number

of new yeasts found in the November samples was partly due to the reappearance of previously isolated OTUs (Table 1 and Supplementary Table S1). However, it was apparent that the diversity

of yeasts was much higher in the samples collected in spring than those from autumn. In the M sample from Kulosaari in April 2015, 23 new OTUs were discovered from 32 colonies.

IDENTIFICATION OF YEASTS The ITS region from all unique OTUs was sequenced and compared to the NCBI database identifying 95 yeast strains representing 23 species in nine genera (Table 2).

There were two species in two genera of the phylum Ascomycota and 21 species in seven genera of the phylum Basidiomycota. Ascomycete yeasts represented 6.3% of total and 93.7% were

Basidiomycete. _Cryptococcus_ was by far the dominant genus in the arabidopsis phyllosphere, accounting over half of all isolates. OTUs similar to _C. victoriae_ strains accounted for 41% of

total isolates within the genus _Cryptococcus_ (Fig. 2). However, there was a rich diversity of _Cryptococcus_ present with a total of 20 OTUs represented. The behaviour of a selected

subset of isolated yeasts was monitored in several physiological assays in order to understand aspects of yeast lifestyle, support the assertion that these species are specifically

associated with arabidopsis, and characterize the nature of their host-yeast interaction. The following isolates were selected, as a representative set of genera in this study:

_Cryptococcus_ sp. OTU 9, _Cryptococcus_ sp. OTU 4, _Leucosporidium_ sp. OTU 26, _Taphrina_ sp. OTU 3, _Protomyces_ sp. OTU 1, _Dioszegia_ sp. OTU 23 strain 1, _Dioszegia_ sp. OTU 23 strain

2, _Cryptococcus_ sp. OTU 17, _Cystobasidiomycetes_ sp. OTU 32, _Microbotryozyma_ sp. OTU 28, _Leucosporidium_ sp. OTU 27. Additionally, Baker’s yeast (_Saccharomyces cerevisiae_ L40) and

fission yeast (_Schizosaccharomyces pombe_ FY7519) were used as non-pathogenic control species and the mustard pathogen, _Eremothecium sinecaudum_ BSL-1, was used as a known pathogen of

_Brassicaceae_ family plants21. YEAST PRODUCTION OF INDOLIC COMPOUNDS Both pathogenic and growth-promoting microbes are known to produce the plant hormone auxin, prompting examination of

this trait in our selected yeasts. Indolic compounds, including indole acetic acid (IAA) and other auxins, were detected using the Salkowski reagent colorimetric assay with supernatants from

yeast cultures in media with varied amounts of the auxin precursor tryptophan. Among the 11 selected strains, eight produced indolic compounds when cultivated in glucose yeast peptone (GYP)

medium, which contains moderate levels of tryptophan derived from yeast extract and peptone (Fig. 3). Indole compound production, measured in IAA equivalents (IAA eq.), ranged from 7.25 ± 

0.60 to 24.98 ± 0.75 μg/ml. When cultivated in GYP supplemented with 0.1% tryptophan, production increased, ranging from 11.48 ± 1.80 to 41.45 ± 6.45. For conditions lacking exogenous

tryptophan, a minimal medium of nitrogen base with glucose was used for cultivation. Interestingly, three isolates displayed indole production in minimal medium (Fig. 3), suggesting the

ability to produce indoles in the absence of exogenous tryptophan, which better mimics the conditions in the arabidopsis phyllosphere. ACTIVATION OF AUXIN RESPONSES IN PLANTA The artificial

auxin-responsive promoter _DR5_ is commonly used to monitor the activation of auxin transcriptional response in arabidopsis. To investigate if yeast-derived indolic compounds had auxin

activity _in planta_, arabidopsis roots bearing a construct with the _DR5_ promoter fused to the β-glucuronidase reporter gene (_DR5::GUS_) in the Col-0 accession were incubated with culture

filtrates from five-day-old yeast cultures and monitored by GUS histochemical staining. A 5 μM IAA control treatment and the culture supernatant of _Taphrina_ sp. OTU 3, as a representative

examples of a positive responses, both exhibit strong blue GUS stains in the roots, indicating induction of DR5-promoter activity (Fig. 4). Similar GUS activity was detected in seedlings

treated with culture supernatant of _Taphrina_ sp. OTU 3, _Protomyces_ sp. OTU 1, _Dioszegia_ sp. OTU 23 strain 1, _Saccharomyces cerevisiae, Eremothecium sinecaudum_, as well as light GUS

expressions in seedlings treated with _Leucosporidium_ sp. OTU 26 and _Leucosporidium_ sp. OTU 27 (Supplementary Fig. S1), suggesting the auxin transcriptional response was activated by

exogenous auxin from the yeast culture. Plants treated with an uncultured GYP medium (negative control) or supernatant of _Cryptococcus_ sp. OTU 4, are presented as representative examples

of negative staining results, which exhibited only light staining of root tips (Fig. 4). Similar negative GUS staining was seen in plants treated with supernatants from _Cryptococcus_ sp.

OTU 9, _Cryptococcus_ sp. OTU 17, _Cystobasidiomycetes_ sp. OTU 32, _Dioszegia_ sp. OTU 23 strain 2, _Cryptococcus_ sp. OTU 4, _Microbotryozyma_ sp. OTU 28 and _Schizosaccharomyces pombe_

(Supplementary Fig. 1). The indolic compounds produced by strains _Dioszegia sp_. OTU 23 strain 2, _Cryptococcus_ sp. OTU 4, and _Microbotryozyma_ sp. OTU 28 (Fig. 3) did not trigger auxin

transcriptional responses (Supplementary Fig. 1), indicating the presence of indolic compounds with no IAA activity in these species. CAMALEXIN SENSITIVITY We reasoned that pathogenic and

non-pathogenic yeasts may differ in their sensitivity to growth inhibition by the arabidopsis antimicrobial phytoalexin, camalexin. Yeasts were cultured in liquid media supplemented with 5,

15 and 25 μg/ml camalexin, revealing high variability in the level of camalexin sensitivity (Fig. 5). Many isolates, including control isolates, exhibited a delay at the initial period of

their growth, which suggests these species have inducible camalexin-tolerance mechanisms. Two isolates from genera known to contain plant pathogens (_Taphrina_ sp. OTU 3 and _Protomyces_ sp.

OTU 1) and the control plant pathogen (_Eremothecium sinecaudum_) were sensitive to camalexin at concentrations higher than 15 μg/ml. Isolates from genera not previously known to be

phytopathogens were highly resistant to camalexin of the concentration up to 25 μg/ml (Fig. 5). TEMPERATURE TOLERANCE Most yeasts are mesophilic and grow optimally at temperatures between 20

and 25 °C, but still many species can grow between 2 and 10 °C. All the strains in this study were isolated at 21 °C from plants growing at low temperatures. In order to characterize the

thermotolerance profiles and identify cold-adapted yeasts, growth under four temperature conditions (8, 21, 30, 37 °C) was tested. Seven out of 11 selected strains grew at 8 °C, indicating a

high number of cold-adapted yeasts among our isolates. OTU 4 and OTU 26 grew better at low temperature than at room temperature. Only one strain (OTU 9) grew at 30 °C and at 37 °C (Fig. 6).

DISCUSSION In this study we have isolated yeasts from the arabidopsis phylloplane. Among the yeast isolates presented here, 22 OTUs belong to the phylum Basidiomycota, which was much more

abundant than the phylum Ascomycota with only two OTUs. The Ascomycete and Basidiomycete ratio is less than those of yeasts isolated in tropical regions5,7,22, subtropical areas8 and

temperate areas23,24. However, Ascomycete yeasts may also dominate in the phyllosphere of plants in tropical regions, when the isolation was performed using a higher temperature7.

Interestingly, a study of seasonal dynamics demonstrated the abundance of _Ascomycete_s increased gradually from spring to autumn23. In Finland and other northern counties, arabidopsis seeds

germinate in the autumn and grow until usually November, when temperatures drop, overwintering as a small rosette, often under snow cover, until growth resumes in the spring, typically in

April. The lifecycle is then completed with seed set in late May or early June. Accordingly, a high percentage of low-temperature adapted yeasts were isolated from plants sampled in May,

whose rosettes had overwintered under snow. Some plant pathogens are specialized for infection during winter and there is currently no genetically tractable model pathosystem for such

interactions. Further studies are required, however, some of the isolates presented here may have potential for the development of a low temperature adapted pathogen model system. Auxin

production by a plant-associated microorganism was first reported by Kaper and Veldstra25. Auxin of microbial origin has been shown to play a wide variety of roles26. Within and between

microbes, IAA can function as a signalling molecule regulating microbial gene expression, promoting growth-form switching, and potentially as a quorum sensing molecule26,27,28. In pathogenic

microbes, IAA functions in tumour or gall formation, suppression of plant immune-signalling and aiding pathogen ingress via induction of plant cell wall expansion and weakening29.

Remarkably, two potentially pathogenic OTUs isolated here (OTU 1 and 3), both of which exhibited the ability to produce indolic compounds and induce an auxin response _in planta_, both come

from genera known to induce plant tumours as disease symptoms (_Protomyces_ and _Taphrina_). In plant-growth promoting microorganisms, IAA results in enhanced root-proliferation, increased

mineral adsorption, and increased basal defence9,14. Given the variety of these responses, diverse model systems are needed for the study IAA in plant-microbe interactions in different

contexts. Although IAA-producing yeasts have been characterized from many other plants, and IAA-producing bacteria and fungi that interact with arabidopsis are known, this study offers the

first opportunity for a yeast-arabidopsis interaction involving this plant hormone. In this study, we isolated several potentially arabidopsis-associated yeasts with the ability to produce

indolic compounds. Among the tested eleven yeast isolates, eight isolates exhibited significant production of indolic compounds when cultivated in various media with different levels of

exogenous tryptophan. Tryptophan is the main precursor for IAA biosynthesis pathway in most organisms and there are five different biosynthesis pathways known leading from tryptophan to

IAA26. Additionally, a tryptophan-independent pathway exists in bacteria and fungi27,30. Three isolates (_Leucosporidium_ sp. OTU 26, _Microbotryozyma_ sp. OTU 28 and _Leucosporidium_ sp.

OTU 27) exhibited the production of indolic compounds in the absence of tryptophan in the growth medium. Culture filtrates from two of these isolates (OTU 26 and OTU 27) had _in planta_

auxin activity (Supplementary Fig. S1). Most studies reporting microbial auxin production utilize growth media containing exogenous tryptophan or containing yeast extract or peptone, which

contain high levels of tryptophan. In contrast, tryptophan was reported as a low abundance amino acid in oat and barley leaf exudates20. Here we demonstrate yeasts with the ability to

produce auxins or other indolic compounds under conditions more similar to the low tryptophan levels expected in the phylloplane. These yeasts may use either endogenous _de novo_ tryptophan

biosynthesis or a non-tryptophan-dependent IAA/indole biosynthesis pathway. In general, most of the assayed yeast-culture filtrates that contained indolic compounds were also shown to have

auxin activity in the induction of a transcriptional marker in arabidopsis suggesting that they contain auxins. It has been proposed that indolic compound production by yeasts is a general

adaptation strategy for plant phyllosphere environment9. Since our yeast strains were isolated from wild arabidopsis plants, without any disease symptoms, indolic compound production may be

an important indicator for plant associated beneficial or neutral microbes. The indole alkaloid, camalexin (3-thiazol-2′-yl-indole), is the major anti-microbial phytoalexin in arabidopsis.

Like other low molecular weight antimicrobial compounds, camalexin synthesis is rapidly induced by plant pathogens31,32,33,34. Several arabidopsis pathogens are known to be sensitive to

camalexin35, which contributes to arabidopsis pathogen immunity36,37. Cell membrane disruption is considered as the primary mode of camalexin toxicity against bacterial, fungal and plant

cells38. Sensitivity to camalexin is not restricted to strictly to pathogenic species; both resistant and sensitive isolates were found within _Botrytis cinerea_36. However, fungal pathogens

generally have a much lower toxicity threshold than bacterial pathogens and host plant cells38. In this study, the high sensitivity of three potentially pathogenic yeast isolates (Fig. 5)

confirmed the low toxicity threshold of pathogenic fungi. It has been shown that culture media supplemented with 20 μg/ml camalexin caused a significant decrease in spore germination and

hyphal growth of _Botrytis cinerea_ isolates36, which is in accordance to the sensitivity of three potentially pathogenic yeast isolates to 15 μg/ml camalexin. Several fungi are reported to

have tolerance against camalexin by its active degradation into less toxic compounds39,40. Similarly, the non-pathogenic yeast strains exhibited high tolerance in cultures with camalexin

concentrations up to 25 μg/ml. Although they might be sensitive higher camalexin concentrations38, these are not realistic to the situation in the phyllosphere of arabidopsis, where it has

been estimated that camalexin accumulation reached a maximum of 8 μg/g leaf fresh weight in arabidopsis after inoculation with a bacterial pathogen41. Remarkably, in the control experiments,

higher camalexin tolerance was a characteristic of the non-pathogenic species (_S. pombe_ and _S. cerevisiae_), while the control pathogen (_Eremothecium_) was more sensitive. This trend

also held among the strains isolated here, genera previously known to be plant pathogens were sensitive, while genera with no previous report of plant pathogenicity tended to be tolerant

(see Fig. 5 and discussion of the individual genera below). This is consistent with the pathogen lifestyle and virulence strategy; pathogens do not require camalexin tolerance as they can

avoid camalexin, via subverting immune signalling pathways with effector proteins and other virulence mechanisms. Thus we contend that, although not a perfect indicator all of the time,

camalexin sensitivity can be used as a guide in the identification of potential latent pathogens among phylloplane resident microbes. All the yeast genera isolated from _the_ arabidopsis

phyllosphere have been previously demonstrated to be associated with plants. Several have also been previously found to be associated with arabidopsis. Recently, Alger _et al_.42

characterized the arabidopsis phyllosphere using metagenomics. This study independently verified the presence of OTUs in the genera _Protomyces, Dioszegia, Leucosporidium_, and

_Rhodotorula_, in the phyllosphere of arabidopsis collected from two distant sites in Germany. This suggests that these yeasts may indeed belong to the recurring core phyllosphere of

arabidopsis. The characteristics of each genus found in our isolations are individually discussed below. _Cryptococcus_ is the dominant genus in phyllosphere of arabidopsis in this study.

Members of the genus _Cryptococcus_ are widely distributed and were described as a dominant species in the phyllosphere of other plants, such as carnivorous plant9, spruce and birch23.

Another group of yeast commonly found in the phyllosphere of many plants, _Dioszegia_ spp. have been previously detected on plant leaves and roots, and even polar desert soil10,43,44,45.

Some novel psychrophilic species in this genus isolated from Antarctica have been previously described45. The world-wide distribution of the _Cryptococcus_ and _Dioszegia_ species may due to

the extreme temperature tolerance and the ability to utilize the nutrients from harsh environments. Among 11 tested isolates, two _Dioszegia_ isolates and two _Cryptococcus_ isolates

performed active growth at low temperature, suggesting the possible cold adaptation in northern climates. A _Dioszegia_ sp. was previously found in the arabidopsis phyllosphere42 and found

to act as a so called “hub” microbe, which are species that have a role in organizing the microbiome community. Specifically, presumably via direct microbe-microbe interactions, _Dioszegia_

spp. shaped the prokaryotic microbiome of the plants on which they resided42. Due to the importance of these species, we have sequenced the genome of the _Dioszegia_ sp. OTU 23 isolated in

this study. Analysis of this genome will be presented elsewhere. The genus _Rhodotorula_ is a group of pigmented yeasts, widely variant in colour, being cream to orange, red, pink or yellow.

As a common environmental microbe, _Rhodotorula_ species have been cultured from water, milk, fruit juice, soil and even air samples46. Interestingly, _R. glacialis_ has been studied as an

oleaginous yeast, which might be used for the production of single cell oils47. The studies also demonstrated that under appropriate conditions, this yeast accumulates high amount of lipids.

Additionally, siderophores produced by _Rhodotorula_ strains exhibited antifungal activity against plant pathogens including _Botrytis cinerea_48. _Holtermannia_ is a group of yeast with

wide-spread distribution. _Holtermannia_ strains have been isolated from many natural and artificial substrates from different parts of the world49. Two of the potentially pathogenic yeasts

isolated are from the genera, _Taphrina_ and _Protomyces_, which both belong to the _Taphrinomycotina_. Members of this early diverging _Ascomycete_ subphylum are considered to be ancient

lineages and as such are important for understanding fungal evolution and the evolution of pathogenicity. Established by Unger in 1832, the genus _Protomyces_ was described as pathogens that

cause galls on stems, leaves or fruits on host plants in the families _Compositae_ and _Umbelliferae. Protomyces_ has been strictly defined based morphologically on cell sizes and on their

host range, where only yeasts pathogenic on _Compositae_ and _Umbelliferae_ belong to _Protomyces_50. This is among the first reports to isolate or detect a _Protomyces_ sp., as defined by

ITS sequences, from a plant outside of these two host families. ITS sequences of the _Protomyces_ spp. described here (OTU 1 and OTU 2), place them firmly within the _Protomyces_. However,

these ITS sequences are only 97% and 95% similar to that of their closest BLAST hit _Protomyces inouyei_. This suggests that OTU 1 and 2 are novel _Protomyces_ species with hosts outside of

the defined range. Many yeasts morphologically similar to _Protomyces_ have been characterized but excluded from the genus based on their host plants50; however, descriptions of these

species did not include molecular data (ITS sequences). Taken together, these data suggest that the definition of the genus _Protomyces_ should be revised. It has been previously noted that

genus and species demarcation in _Protomyces_ and the related genera, _Burenia, Protomycopsis, Taphridium_, and _Volkartia,_ are unclear and likely incorrect and that extensive molecular

comparisons are needed51. Relationships within _Protomyces_ are currently being addressed by sequencing the genome of OTU 1 and several reference _Protomyces_ species (Wang, Sipilä and

Overmyer, unpublished data). This work will be presented elsewhere. As a genus closely related to _Protomyces, Taphrina_ contains nearly 100 described species that are parasitic on different

families of primarily woody plants52. Some _Taphrina_ species cause diseases on fruit trees, of which the symptoms are diverse malformations of leaves and other infected tissue53. Species

of genus _Leucosporidium_ were originally transferred from _Rhodotorula_54. Most of the species of this genus were isolated from cold climates51, some of which were described for the ability

to degrade phenol and phenol-related compounds55. One _Leucosporidium_ isolated here is suggested to be cold-adapted because of its active growth at low temperature. The capacity for

biodegradation of phenol and phenol-related compounds by _Leucosporidium_ isolates found in this study may be of biotechnological interest and warrants further study. The genus

_Leucosporidium_ is phylogenetically closely related to _Leucosporidiella_. One of the isolates discovered in this genus (OTU 27), which was most closely related to _Leucosporidium

golubevii_ isolated from river water in Portugal54, grew actively at low temperature in accordance with the psychrophilic nature of this genus. In addition, an unknown isolate was collected

with 86% ITS identity to _Microbotryozyma collariae_, which was described recently as a novel species56. The yeast species in _Cystofilobasidium_ are widely distributed mainly in cold

climates. Interestingly, a _C. capitatum_ strain (PPY-1) was isolated from soil and was suggested may produce novel enzymes that can degrade pectin at low temperature57. Subsequently, a

cold-active extracellular pectin lyase from the strain PPY-1 has been purified58. The ability to produce plant cell wall degrading enzymes may be a survival strategy for several microbe

groups. Production of pectin lyase and related enzymes may be relevant to our strains, future testing for enzymes with these characteristics may have practical application. Metagenomics is

currently the state of the art for the study of plant microbiota and application of this technique to explore the fungi and yeasts in the arabidopsis phyllosphere microbiome gives a more

comprehensive picture of the species present42 and is complementary to this study. The purpose of the present study was to make an initial survey of yeast in the arabidopsis phyllosphere,

isolate strains for use in future studies and physiologically characterize these strains to aid in selecting appropriate strains for developing new model systems with arabidopsis. Currently,

the majority of work on molecular plant-microbe interactions with arabidopsis utilize only a small number of pathogenic species, including mostly bacteria and fungi59,60, but no yeasts.

There is a need to diversify the study of plant pathology and include molecular work on plant yeast interactions. The strain resources and information generated in this study will contribute

significantly to this effort. METHODS SAMPLE COLLECTION AND YEAST ISOLATION Healthy rosettes of arabidopsis (_Arabidopsis thaliana)_ were collected from three distinct sites (in the

Kivikko, Kulosaari and Mustikkamaa districts) in Helsinki, Finland (Table 1). The month average temperature of Helsinki in April, May and November are 4 °C, 10 °C and 0 °C (Finnish

Meteorological Institute; http://en.ilmatieteenlaitos.fi). Plants were collected by sterile scissor and forceps and were placed in sterile 50 ml centrifuge tubes. Samples were kept at

cold-room (4 °C) until yeast isolation procedures. As a pre-wash to remove surface dust, the leaves were vortexed two times in a 2 ml tube containing 1 ml sterile water for 3 seconds. Leaves

were transferred into another 2 ml tube containing 1 ml MQ water with 0.025% Silwet-L77 and were shaken gently for 4 hours on a rocking platform. Serial dilutions of leaf wash solution were

plated onto 0.2 × PDA (potato dextrose agar, Sigma-Aldrich) medium. Single colonies were picked and were streaked twice on 0.2 × PDA medium with 100 μg/ml Ampicillin for purification.

Long-term storage of wash solutions as well as purified strains was performed in 50% sterile glycerol at −80 °C. DNA EXTRACTION Yeast were cultivated in 2 ml 0.2 × PDB (Potato dextrose

broth, Sigma-Aldrich) for 5 days. Cells were pelleted by centrifugation for 5 min at 12,000 _g_ and the pellet was suspended in 200 μl lysis buffer (100 mM Tris-HCl pH8.0, 50 mM EDTA, 500 mM

NaCl). Glass beads (0.3 g) and 200 μl phenol/chloroform/isoamyl alcohol were added and vortexed at high speed for 3 min. Cells were briefly vortexed after adding 200 μl TE buffer. The

samples were centrifuged 5 min at maximum speed. The aqueous layer was transferred to a clean 2 ml centrifuge tube, ethanol precipitated, pelleted by centrifugation and resuspended in 0.4 ml

TE buffer. Following DNase-free RNase A treatment (30 μl of 1 mg/ml, 5 min at 37 °C) samples were ethanol precipitated as above and resuspended in 100 μl TE buffer. YEAST IDENTIFICATION

Sequences of the ITS (internal transcribed spacer) region were determined by polymerase chain reaction (PCR) products from yeast genomic DNA. PCR products were obtained using forward primer

ITS3 (5′-CTTGGTCATTTAGAGGAAGTAA-3′) and reverse primer ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). Each reaction mixture contained 2 μl 10 × fire polymerase buffer B (Solis BioDyne), 1.6 μl MgCl2 (25

 mM), 0.4 μl dNTP, 0.4 μl of each primer (10 mM). After denaturation of DNA at 94 °C for 5 minutes, 35 cycles of amplification with the following thermocycling program: denaturation at 94 °C

for 20 s, followed by 10 s at 50 °C for primer annealing and 30 s at 72 °C for extension. Final extension 5 minutes at 72 °C was used. The PCR products were observed by separating the

fragments with 1.5% agarose gel electrophoresis. ExoSAP (Thermo Scientific™ Exonuclease I, Shrimp Alkaline Phosphatase) treatment of individual PCR products was performed to remove residual

primers. Restriction enzymes HaeIII and TaqI (Thermo scientific) were chosen for ITS fragment digestion, following the manufacturer’s instructions and fragments were observed by separation

by electrophoresis using a 3% agarose gel. Isolates were classified as OTUs (operational taxonomic units) on the basis of a unique ITS restriction pattern with the enzymes HaeIII and TaqI

and corresponding ITS amplicon length. Representatives of each OTU were selected for sequencing with ITS4 and ITS1 (GGAAGTAAAAGTCGTAACAAGG) primers. The complete ITS region was assembled

from the sequencing results (Chromas Lite; Ape). ITS comparison to described fungi species was performed using BLAST (Basic Local Alignment Search Tool) at the NCBI (National Centre for

Biotechnology Information) database. INDOLIC COMPOUND PRODUCTION AND GUS STAINING The production of indolic compounds of selected strains was monitored using Salkowski reagent61. Three

different media (GYP, GYP with 0.1% L-tryptophan, and nitrogen base with 1% glucose) were used. Yeasts were cultured in liquid medium in 96 deep-well plate (P8116, Sigma-Aldrich) for three

days from starting cell density OD = 0.1. Breathable film (A9224, Sigma-Aldrich) was used for sealing the plates. One ml yeast cells were centrifuged at 12,000 g for 5 min, and 0.5 ml

supernatant was mixed well with 0.5 ml Salkowski regent (12 g of FeCl3 per litre in 7.9 M H2SO4). The mixture was kept at darkness for 30 min. The red colour development was quantified

spectrophotometrically (Agilent 8453) as absorbance at wavelength 530 nm. A calibration curve was established using indole-3-acetic acid (IAA) with concentrations of 1, 2, 4, 5, 6, 8, 10 

μg/ml. Experiments were repeated independently three times. An arabidopsis _DR5::GUS_ transgenic line in the Col-0 accession (obtained from the Nottingham Arabidopsis Stock Centre; NASC;

http://arabidopsis.info) was cultivated in 0.5 × Murashige and Skoog15 (M5519, Sigma, USA) with addition of 1% (w/v) agar and 1% (w/v) sucrose (pH = 5.7). Seeds were surface sterilized by

washing with 70% ethanol with 2% Triton X-100 for 5 min, and washed two times with absolute ethanol. Seedlings were grown in 6 well cell culture plates (CLS3516, Corning Costar), with 10

seeds in each well. Plants were placed in growth chamber (16/8, 24 °C). Ten-day-old _DR5::GUS_ seedlings were treated with 1 ml filtered supernatants of 5 day yeast cultures (GYP with 0.1%

L-tryptophan) overnight. Positive control group was treated with 1 ml 5 μM IAA, and 1 ml medium for negative control group. For histochemical staining, seedlings were fixed with ice-cold 90%

acetone for 1 h, washed three times with ice-cold wash solution (36 mM Na2HPO4, 14 mM NaH2PO4, pH 7.2), 30 min for each wash. Seedlings were vacuum infiltrated and kept at room temperature

in GUS staining solution (1 mM 5-bromo-4-chloro-3-indolyl b-D-glucuronide dissolved in methanol, 5 mM potassium ferricyanide and 5 mM potassium ferrocyanide in 50 mM sodium phosphate buffer,

pH 7.2). Stained seedlings were washed three times with absolute ethanol and were kept in 70% ethanol. Experiments were repeated independently three times. CAMALEXIN AND TEMPERATURE

TOLERANCE ASSAYS Eleven selected strains and three control strains were cultivated in liquid GYP medium in 96 deep-well plate, containing 0, 5, 15, 25 μg/ml camalexin (SML1016,

Sigma-Aldrich). The mustard pathogen, _Eremothecium sinecaudum_ BSL-1 (CBS 8199) used as a control was obtained from CBS-KNAW (http://www.cbs.knaw.nl). Plates were shaken at 850 rpm at 21 °C

in a growth chamber. Absorbance density at 600 nm of cultures were measured at several time points (day 0, 1, 2, 3, 4, 6, 8) as indication of yeast density. Yeast growth at different

camalexin concentrations were measured from starting cell density OD = 0.1. Experiments were repeated independently three times. For temperature growth experiments, yeast strains were first

cultivated in liquid GYP medium for three days, then diluted to OD = 1 with medium. Serial dilutions (10−1 to 10−7) were prepared. Drop plating with 2 μl of each dilution was conducted in

square GYP agar plates. The strains were cultivated at 8 °C, 21 °C, 30 °C and 37 °C conditions. Colony forming units (CFUs) were counted to determine growth after seven days. Experiments

were repeated independently three times. ADDITIONAL INFORMATION HOW TO CITE THIS ARTICLE: Wang, K. _et al_. The isolation and characterization of resident yeasts from the phylloplane of

_Arabidopsis thaliana. Sci. Rep._ 6, 39403; doi: 10.1038/srep39403 (2016). PUBLISHER'S NOTE: Springer Nature remains neutral with regard to jurisdictional claims in published maps and

institutional affiliations. REFERENCES * Conn, V. M., Walker, A. R. & Franco, C. M. M. Endophytic Actinobacteria Induce Defense Pathways in Arabidopsis thaliana. Molecular Plant-Microbe

Interactions 21, 208–218, doi: 10.1094/MPMI-21-2-0208 (2008). Article  CAS  PubMed  Google Scholar  * van der Lelie, D. et al. Poplar and its Bacterial Endophytes: Coexistence and Harmony.

Critical Reviews in Plant Sciences 28, 346–358, doi: 10.1080/07352680903241204 (2009). Article  CAS  Google Scholar  * Rodriguez, R. J. et al. Stress tolerance in plants via habitat-adapted

symbiosis. ISME J 2, 404–416 (2008). PubMed  Google Scholar  * Marschner, H., Römheld, V., Horst, W. J. & Martin, P. Root-induced changes in the rhizosphere: Importance for the mineral

nutrition of plants. Zeitschrift für Pflanzenernährung und Bodenkunde 149, 441–456, doi: 10.1002/jpln.19861490408 (1986). Article  CAS  Google Scholar  * Nakasel’s, T. et al.

Ballistoconidium—Forming Yeasts Found in the Phyllosphere of Thailand. Group 500 (1987). * Limtong, S., Kaewwichian, R., Yongmanitchai, W. & Kawasaki, H. Diversity of culturable yeasts

in phylloplane of sugarcane in Thailand and their capability to produce indole-3-acetic acid. World Journal of Microbiology and Biotechnology 30, 1785–1796 (2014). CAS  PubMed  Google

Scholar  * Limtong, S. & Kaewwichian, R. The diversity of culturable yeasts in the phylloplane of rice in Thailand. Annals of Microbiology 65, 667–675 (2015). CAS  Google Scholar  *

Inácio, J. et al. Estimation and diversity of phylloplane mycobiota on selected plants in a mediterranean–type ecosystem in Portugal. Microbial Ecology 44, 344–353 (2002). PubMed  Google

Scholar  * Sun, P. F. et al. Indole-3-acetic acid-producing yeasts in the phyllosphere of the carnivorous plant Drosera indica L. PloS one 9, e114196, doi: 10.1371/journal.pone.0114196

(2014). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  * Inácio, J., Portugal, L., Spencer-Martins, I. & Fonseca, Á. Phylloplane yeasts from Portugal: seven novel anamorphic

species in the Tremellales lineage of the Hymenomycetes (Basidiomycota) producing orange-coloured colonies. FEMS yeast research 5, 1167–1183 (2005). PubMed  Google Scholar  * Ryffel, F. et

al. Metabolic footprint of epiphytic bacteria on Arabidopsis thaliana leaves. The ISME journal (2015). * Mercier, J. & Lindow, S. Role of leaf surface sugars in colonization of plants by

bacterial epiphytes. Applied and Environmental Microbiology 66, 369–374 (2000). CAS  PubMed  PubMed Central  Google Scholar  * Brandl, M. & Lindow, S. Contribution of indole-3-acetic

acid production to the epiphytic fitness of Erwinia herbicola. Applied and environmental microbiology 64, 3256–3263 (1998). CAS  PubMed  PubMed Central  Google Scholar  * Contreras-Cornejo,

H. A., Macías-Rodríguez, L., Cortés-Penagos, C. & López-Bucio, J. Trichoderma virens, a plant beneficial fungus, enhances biomass production and promotes lateral root growth through an

auxin-dependent mechanism in Arabidopsis. Plant Physiology 149, 1579–1592 (2009). CAS  PubMed  PubMed Central  Google Scholar  * Ahmad, F., Ahmad, I. & Khan, M. Screening of free-living

rhizospheric bacteria for their multiple plant growth promoting activities. Microbiological research 163, 173–181 (2008). CAS  PubMed  Google Scholar  * Jones, J. D. & Dangl, J. L. The

plant immune system. Nature 444, 323–329 (2006). ADS  CAS  PubMed  Google Scholar  * Dangl, J. L. & Jones, J. D. G. Plant pathogens and integrated defence responses to infection. Nature

411, 826–833 (2001). ADS  CAS  PubMed  Google Scholar  * Cheng, S. C., Joosten, L. A., Kullberg, B. J. & Netea, M. G. Interplay between Candida albicans and the mammalian innate host

defense. Infection and immunity 80, 1304–1313, doi: 10.1128/iai.06146-11 (2012). Article  CAS  PubMed  PubMed Central  Google Scholar  * Raacke, I. C., von Rad, U., Mueller, M. J. &

Berger, S. Yeast Increases Resistance in Arabidopsis Against Pseudomonas syringae and Botrytis cinerea by Salicylic Acid-Dependent as Well as -Independent Mechanisms. Molecular Plant-Microbe

Interactions 19, 1138–1146, doi: 10.1094/MPMI-19-1138 (2006). Article  CAS  PubMed  Google Scholar  * Weibull, J., Ronquist, F. & Brishammar, S. Free Amino Acid Composition of Leaf

Exudates and Phloem Sap: A Comparative Study in Oats and Barley. Plant Physiology 92, 222–226 (1990). CAS  PubMed  PubMed Central  Google Scholar  * Kurtzman, C. P. Relationships among the

genera Ashbya, Eremothecium, Holleya and Nematospora determined from rDNA sequence divergence. J Ind Microbiol 14, 523–530 (1995). CAS  PubMed  Google Scholar  * de Azeredo, L. A. I., Gomes,

E. A. T., Mendonça-Hagler, L. C. & Hagler, A. N. Yeast communities associated with sugarcane in Campos, Rio de Janeiro, Brazil. International Microbiology 1, 205–208 (2010). Google

Scholar  * Maksimova, I. A. & Chernov, I. [Community structure of yeast fungi in forest biogeocenoses]. Mikrobiologiia 73, 558–566 (2004). CAS  PubMed  Google Scholar  * SlÁviková, E.,

Vadkertiová, R. & Vránová, D. Yeasts colonizing the leaves of fruit trees. Annals of microbiology 59, 419–424 (2009). Google Scholar  * Kaper, J. & Veldstra, H. On the metabolism of

tryptophan by Agrobacterium tumefaciens. Biochimica et biophysica acta 30, 401–420 (1958). CAS  PubMed  Google Scholar  * Spaepen, S., Vanderleyden, J. & Remans, R. Indole‐3‐acetic acid

in microbial and microorganism‐plant signaling. FEMS microbiology reviews 31, 425–448 (2007). CAS  PubMed  Google Scholar  * Rao, R. P., Hunter, A., Kashpur, O. & Normanly, J. Aberrant

Synthesis of Indole-3-Acetic Acid in Saccharomyces cerevisiae Triggers Morphogenic Transition, a Virulence Trait of Pathogenic Fungi. Genetics 185, 211–220, doi: 10.1534/genetics.109.112854

(2010). Article  CAS  PubMed  PubMed Central  Google Scholar  * Sprague, G. F. & Winans, S. C. Eukaryotes learn how to count: quorum sensing by yeast. Genes & development 20,

1045–1049 (2006). CAS  Google Scholar  * Spaepen, S. & Vanderleyden, J. Auxin and plant-microbe interactions. Cold Spring Harbor perspectives in biology 3, a001438 (2011). PubMed  PubMed

Central  Google Scholar  * Prinsen, E., Costacurta, A., Michiels, K., Vanderleyden, J. & Van Onckelen, H. Azospirillum brasilense indole-3-acetic acid biosynthesis: evidence for a

non-tryptophan dependent pathway. Molecular Plant Microbe Interactions 6, 609–609 (1993). CAS  Google Scholar  * Glazebrook, J. et al. Phytoalexin-deficient mutants of Arabidopsis reveal

that PAD4 encodes a regulatory factor and that four PAD genes contribute to downy mildew resistance. Genetics 146, 381–392 (1997). CAS  PubMed  PubMed Central  Google Scholar  * Glazebrook,

J. & Ausubel, F. M. Isolation of phytoalexin-deficient mutants of Arabidopsis thaliana and characterization of their interactions with bacterial pathogens. Proceedings of the National

Academy of Sciences 91, 8955–8959 (1994). ADS  CAS  Google Scholar  * Callaway, A. et al. Characterization of cauliflower mosaic virus (CaMV) resistance in virus-resistant ecotypes of

Arabidopsis. MPMI-Molecular Plant Microbe Interactions 9, 810–818 (1996). CAS  Google Scholar  * Roetschi, A., Si‐Ammour, A., Belbahri, L., Mauch, F. & Mauch‐Mani, B. Characterization of

an Arabidopsis–Phytophthora pathosystem: resistance requires a functional PAD2 gene and is independent of salicylic acid, ethylene and jasmonic acid signalling. The Plant Journal 28,

293–305 (2001). CAS  PubMed  Google Scholar  * Thomma, B. P., Nelissen, I., Eggermont, K. & Broekaert, W. F. Deficiency in phytoalexin production causes enhanced susceptibility of

Arabidopsis thaliana to the fungus Alternaria brassicicola. The Plant Journal 19, 163–171 (1999). CAS  PubMed  Google Scholar  * Kliebenstein, D. J., Rowe, H. C. & Denby, K. J. Secondary

metabolites influence Arabidopsis/Botrytis interactions: variation in host production and pathogen sensitivity. The Plant Journal 44, 25–36 (2005). CAS  PubMed  Google Scholar  * Bohman,

S., Staal, J., Thomma, B. P., Wang, M. & Dixelius, C. Characterisation of an Arabidopsis–Leptosphaeria maculans pathosystem: resistance partially requires camalexin biosynthesis and is

independent of salicylic acid, ethylene and jasmonic acid signalling. The Plant Journal 37, 9–20 (2004). CAS  PubMed  Google Scholar  * Rogers, E. E., Glazebrook, J. & Ausubel, F. M.

Mode of action of the Arabidopsis thaliana phytoalexin camalexin and its role in Arabidopsis-pathogen interactions. Molecular Plant Microbe Interactions 9, 748–757 (1996). CAS  PubMed 

Google Scholar  * Soledade, M., Pedras, C. & Khan, A. Q. Unprecedented detoxification of the cruciferous phytoalexin camalexin by a root phytopathogen. Bioorganic & Medicinal

Chemistry Letters 7, 2255–2260 (1997). CAS  Google Scholar  * Pedras, M. S. C. & Khan, A. Q. Biotransformation of the phytoalexin camalexin by the phytopathogen Rhizoctonia solani.

Phytochemistry 53, 59–69 (2000). CAS  PubMed  Google Scholar  * Tsuji, J., Jackson, E. P., Gage, D. A., Hammerschmidt, R. & Somerville, S. C. Phytoalexin accumulation in Arabidopsis

thaliana during the hypersensitive reaction to Pseudomonas syringae pv syringae. Plant Physiology 98, 1304–1309 (1992). CAS  PubMed  PubMed Central  Google Scholar  * Agler, M. T. et al.

Microbial Hub Taxa Link Host and Abiotic Factors to Plant Microbiome Variation. PLoS Biol 14, e1002352, doi: 10.1371/journal.pbio.1002352 (2016). Article  CAS  PubMed  PubMed Central  Google

Scholar  * Wang, Q.-M., Jia, J.-H. & Bai, F.-Y. Diversity of basidiomycetous phylloplane yeasts belonging to the genus Dioszegia (Tremellales) and description of Dioszegia athyri sp.

nov., Dioszegia butyracea sp. nov. and Dioszegia xingshanensis sp. nov. Antonie van Leeuwenhoek 93, 391–399 (2008). PubMed  Google Scholar  * Renker, C., Blanke, V., Börstler, B., Heinrichs,

J. & Buscot, F. Diversity of Cryptococcus and Dioszegia yeasts (Basidiomycota) inhabiting arbuscular mycorrhizal roots or spores. FEMS yeast research 4, 597–603 (2004). CAS  PubMed 

Google Scholar  * Connell, L. B. et al. Dioszegia antarctica sp. nov. and Dioszegia cryoxerica sp. nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica.

International journal of systematic and evolutionary microbiology 60, 1466–1472 (2010). CAS  PubMed  Google Scholar  * Wirth, F. & Goldani, L. Z. Epidemiology of Rhodotorula: an emerging

pathogen. Interdisciplinary perspectives on infectious diseases 2012 (2012). * Amaretti, A. et al. Single cell oils of the cold-adapted oleaginous yeast Rhodotorula glacialis DBVPG 4785.

Microbial cell factories 9, 1 (2010). Google Scholar  * Calvente, V., De Orellano, M., Sansone, G., Benuzzi, D. & De Tosetti, M. S. Effect of nitrogen source and pH on siderophore

production by Rhodotorula strains and their application to biocontrol of phytopathogenic moulds. Journal of Industrial Microbiology and Biotechnology 26, 226–229 (2001). CAS  PubMed  Google

Scholar  * Wuczkowski, M. et al. Description of Holtermanniella gen. nov., including Holtermanniella takashimae sp. nov. and four new combinations, and proposal of the order Holtermanniales

to accommodate tremellomycetous yeasts of the Holtermannia clade. International journal of systematic and evolutionary microbiology 61, 680–689 (2011). CAS  PubMed  Google Scholar  * Reddy,

M. S. & Kramer, C. A taxonomic revision of the Protomycetales (Burenia, Fungi). Mycotaxon (1975). * Kurtzman, C., Fell, J. W. & Boekhout, T. The yeasts: a taxonomic study (Elsevier,

2011). * Rodrigues, M. G. & Fonseca, Á. Molecular systematics of the dimorphic ascomycete genus Taphrina. International journal of systematic and evolutionary microbiology 53, 607–616

(2003). CAS  PubMed  Google Scholar  * Mix, A. J. A monograph of the genus Taphrina. University of Kansas Science Bulletin 33 (1949). Google Scholar  * Sampaio, J. P., Gadanho, M., Bauer, R.

& Weiß, M. Taxonomic studies in the Microbotryomycetidae: Leucosporidium golubevii sp. nov., Leucosporidiella gen. nov. and the new orders Leucosporidiales and Sporidiobolales.

Mycological Progress 2, 53–68 (2003). Google Scholar  * Bergauer, P., Fonteyne, P.-A., Nolard, N., Schinner, F. & Margesin, R. Biodegradation of phenol and phenol-related compounds by

psychrophilic and cold-tolerant alpine yeasts. Chemosphere 59, 909–918 (2005). ADS  CAS  PubMed  Google Scholar  * Suh, S.-O., Maslov, D. A., Molestina, R. E. & Zhou, J. J.

Microbotryozyma collariae gen. nov., sp. nov., a basidiomycetous yeast isolated from a plant bug Collaria oleosa (Miridae). Antonie van Leeuwenhoek 102, 99–104 (2012). PubMed  Google Scholar

  * Nakagawa, T., Nagaoka, T., Taniguchi, S., Miyaji, T. & Tomizuka, N. Isolation and characterization of psychrophilic yeasts producing cold‐adapted pectinolytic enzymes. Letters in

Applied Microbiology 38, 383–387 (2004). CAS  PubMed  Google Scholar  * Nakagawa, T., Nagaoka, T., Miyaji, T. & Tomizuka, N. A cold‐active pectin lyase from the psychrophilic and

basidiomycetous yeast Cystofilobasidium capitatum strain PPY‐1. Biotechnology and applied biochemistry 42, 193–196 (2005). CAS  PubMed  Google Scholar  * Mansfield, J. et al. Top 10 plant

pathogenic bacteria in molecular plant pathology. Mol Plant Pathol 13, 614–629, doi: 10.1111/j.1364-3703.2012.00804.x (2012). Article  PubMed  PubMed Central  Google Scholar  * Dean, R. et

al. The Top 10 fungal pathogens in molecular plant pathology. Molecular Plant Pathology 13, 414–430, doi: 10.1111/j.1364-3703.2011.00783.x (2012). Article  PubMed  PubMed Central  Google

Scholar  * Glickmann, E. & Dessaux, Y. A critical examination of the specificity of the salkowski reagent for indolic compounds produced by phytopathogenic bacteria. Applied and

environmental microbiology 61, 793–796 (1995). CAS  PubMed  PubMed Central  Google Scholar  Download references ACKNOWLEDGEMENTS K.W. is a member of the University of Helsinki Doctoral

Program in Plant Science (DPPS). Leena Grönholm is acknowledged for excellent technical support and thank Fuqiang Cui and Xin Wang for their kind assistance with GUS staining. Members of

Plant Stress Meta-Group are acknowledged for many fruitful discussions. This work was supported by the following grants: Academy of Finland Fellowship (decisions no. 251397, 256073 and

283254) to K.O. Academy of Finland Centre of Excellence in Primary Producers 2014–2019 (decision #271832). The Nottingham Arabidopsis Stock Centre (NASC) is acknowledged for arabidopsis

seeds and the CBS-KNAW Fungal Biodiversity Centre for the _Eremothecium sinecaudum_ strain. AUTHOR INFORMATION AUTHORS AND AFFILIATIONS * Division of Plant Biology, Department of

Biosciences, Viikki Plant Science Centre, University of Helsinki, Helsinki, Finland Kai Wang, Timo P. Sipilä & Kirk Overmyer Authors * Kai Wang View author publications You can also

search for this author inPubMed Google Scholar * Timo P. Sipilä View author publications You can also search for this author inPubMed Google Scholar * Kirk Overmyer View author publications

You can also search for this author inPubMed Google Scholar CONTRIBUTIONS K.O. conceived the research, K.W. performed all experiments, K.W. and K.O., wrote the manuscript, all authors

designed experiments, analysed data, edited and approved the manuscript. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing financial interests. ELECTRONIC

SUPPLEMENTARY MATERIAL SUPPLEMENTARY INFORMATION RIGHTS AND PERMISSIONS This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party

material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons

license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ Reprints

and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Wang, K., Sipilä, T. & Overmyer, K. The isolation and characterization of resident yeasts from the phylloplane of _Arabidopsis

thaliana_. _Sci Rep_ 6, 39403 (2016). https://doi.org/10.1038/srep39403 Download citation * Received: 12 July 2016 * Accepted: 23 November 2016 * Published: 22 December 2016 * DOI:

https://doi.org/10.1038/srep39403 SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is not currently

available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative